Transcript: Human NM_024613.4

Homo sapiens pleckstrin homology and FYVE domain containing 2 (PLEKHF2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PLEKHF2 (79666)
Length:
2901
CDS:
261..1010

Additional Resources:

NCBI RefSeq record:
NM_024613.4
NBCI Gene record:
PLEKHF2 (79666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276266 AGCAAATACTAGACGTATAAG pLKO_005 287 CDS 100% 13.200 18.480 N PLEKHF2 n/a
2 TRCN0000136403 CGGATTTGTGACTTCTGCTAT pLKO.1 864 CDS 100% 4.950 6.930 N PLEKHF2 n/a
3 TRCN0000285507 CGGATTTGTGACTTCTGCTAT pLKO_005 864 CDS 100% 4.950 6.930 N PLEKHF2 n/a
4 TRCN0000137449 GCCAGTCATTGAAGTCTCCTT pLKO.1 943 CDS 100% 2.640 2.112 N PLEKHF2 n/a
5 TRCN0000133770 CTTAAGGAATGGATGGCTAAT pLKO.1 545 CDS 100% 10.800 7.560 N PLEKHF2 n/a
6 TRCN0000276264 CTTAAGGAATGGATGGCTAAT pLKO_005 545 CDS 100% 10.800 7.560 N PLEKHF2 n/a
7 TRCN0000134121 CCTGAGAAACTTGTAACCTAT pLKO.1 1118 3UTR 100% 4.950 3.465 N PLEKHF2 n/a
8 TRCN0000276218 CCTGAGAAACTTGTAACCTAT pLKO_005 1118 3UTR 100% 4.950 3.465 N PLEKHF2 n/a
9 TRCN0000192213 CGATGATGATAGCAGTGACTA pLKO.1 989 CDS 100% 4.950 3.465 N Plekhf2 n/a
10 TRCN0000136051 GCTGCAAACAACTACAGTCTT pLKO.1 2379 3UTR 100% 4.950 3.465 N PLEKHF2 n/a
11 TRCN0000135464 GTATGCGTTGTCAGAAAGCAA pLKO.1 733 CDS 100% 3.000 2.100 N PLEKHF2 n/a
12 TRCN0000276265 TTCTTGTATATGGCAATATTG pLKO_005 442 CDS 100% 13.200 7.920 N PLEKHF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04104 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04104 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475240 ACGACTTGCACTGCACGCAAACAT pLX_317 60.4% 100% 100% V5 n/a
Download CSV