Transcript: Human NM_024650.3

Homo sapiens chromosome 11 open reading frame 80 (C11orf80), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-19
Taxon:
Homo sapiens (human)
Gene:
C11orf80 (79703)
Length:
2323
CDS:
8..2041

Additional Resources:

NCBI RefSeq record:
NM_024650.3
NBCI Gene record:
C11orf80 (79703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430411 GCCGTTATCCCGTGGTTTAAT pLKO_005 2089 3UTR 100% 15.000 21.000 N C11orf80 n/a
2 TRCN0000150231 GCACAAAGTATTTCGTGAGAT pLKO.1 1609 CDS 100% 4.950 6.930 N C11orf80 n/a
3 TRCN0000149555 GCCGATGACTACTTTCTTCAA pLKO.1 1099 CDS 100% 4.950 6.930 N C11orf80 n/a
4 TRCN0000416452 TAACACCCTTCCAGATGATTT pLKO_005 615 CDS 100% 13.200 9.240 N C11orf80 n/a
5 TRCN0000431109 TCTCAATTTGGATAGAGATTT pLKO_005 1180 CDS 100% 13.200 9.240 N C11orf80 n/a
6 TRCN0000421709 TTGTGTATGATACCCAATTTG pLKO_005 1157 CDS 100% 13.200 9.240 N C11orf80 n/a
7 TRCN0000148317 CCAACCAGCTTAACAGGATTT pLKO.1 1014 CDS 100% 10.800 7.560 N C11orf80 n/a
8 TRCN0000130964 CTTCAGAGGAAGGCAGCTATT pLKO.1 576 CDS 100% 10.800 7.560 N C11orf80 n/a
9 TRCN0000148349 CACCCTAAGGTCAGATTTCAT pLKO.1 716 CDS 100% 5.625 3.938 N C11orf80 n/a
10 TRCN0000148430 CATCCAATTCACTGTGGACAA pLKO.1 1414 CDS 100% 4.050 2.835 N C11orf80 n/a
11 TRCN0000149537 GTATTCTGACTGGAAGCACTA pLKO.1 1518 CDS 100% 4.050 2.835 N C11orf80 n/a
12 TRCN0000129005 GATCAGTCTCAGACTATGGAT pLKO.1 1244 CDS 100% 3.000 2.100 N C11orf80 n/a
13 TRCN0000149705 GATGTGAGTTATCAGGTGGAA pLKO.1 1211 CDS 100% 2.640 1.848 N C11orf80 n/a
14 TRCN0000148657 CCAGCATTATGTGAGACCAAA pLKO.1 838 CDS 100% 4.950 2.970 N C11orf80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.