Transcript: Human NM_024742.2

Homo sapiens armadillo repeat containing 5 (ARMC5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ARMC5 (79798)
Length:
4707
CDS:
530..2707

Additional Resources:

NCBI RefSeq record:
NM_024742.2
NBCI Gene record:
ARMC5 (79798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427340 AGTACGCGAGGGAACCATTCT pLKO_005 1417 CDS 100% 4.950 6.930 N ARMC5 n/a
2 TRCN0000423932 CTATGTCGTGAGGCCATCAAC pLKO_005 1592 CDS 100% 4.950 6.930 N ARMC5 n/a
3 TRCN0000153937 CAAGGATGAATTGGCTGTGAA pLKO.1 4424 3UTR 100% 4.950 3.960 N ARMC5 n/a
4 TRCN0000156262 CCCTTTGGTGACCATTCTTCA pLKO.1 997 CDS 100% 4.950 3.465 N ARMC5 n/a
5 TRCN0000157871 CCTGTCCTGCATCATTTGCAT pLKO.1 3991 3UTR 100% 3.000 2.100 N ARMC5 n/a
6 TRCN0000156643 GAAGACAGACAGCATCCAGAA pLKO.1 1024 CDS 100% 4.050 2.430 N ARMC5 n/a
7 TRCN0000156769 GTGCATGAAGACAGACAGCAT pLKO.1 1018 CDS 100% 2.640 1.584 N ARMC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12618 pDONR223 100% 56.3% 51.3% None (many diffs) n/a
2 ccsbBroad304_12618 pLX_304 0% 56.3% 51.3% V5 (many diffs) n/a
3 TRCN0000475110 TGCGACTAACCGTGGCAGGCCAGT pLX_317 16.5% 56.3% 51.3% V5 (many diffs) n/a
Download CSV