Transcript: Human NM_024869.3

Homo sapiens family with sequence similarity 110 member D (FAM110D), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM110D (79927)
Length:
2799
CDS:
129..944

Additional Resources:

NCBI RefSeq record:
NM_024869.3
NBCI Gene record:
FAM110D (79927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254407 GCAAGGCTTCGGTGAACAAAG pLKO_005 406 CDS 100% 10.800 8.640 N Grrp1 n/a
2 TRCN0000143804 GATGAGCAAACCTGCTGAATA pLKO.1 1187 3UTR 100% 13.200 9.240 N FAM110D n/a
3 TRCN0000141721 GAAGCCGACAAAGCCAAGTAT pLKO.1 192 CDS 100% 5.625 3.938 N FAM110D n/a
4 TRCN0000122004 GCAAACCTGCTGAATAAAGTT pLKO.1 1192 3UTR 100% 5.625 3.938 N FAM110D n/a
5 TRCN0000141083 CAAGGCTTCGGTGAACAAAGA pLKO.1 407 CDS 100% 4.950 3.465 N FAM110D n/a
6 TRCN0000141382 CCTTCCTTCTGGAACTCAGTT pLKO.1 1034 3UTR 100% 4.950 3.465 N FAM110D n/a
7 TRCN0000142046 GAAGGAGCGCTTCTTCAACTA pLKO.1 611 CDS 100% 4.950 3.465 N FAM110D n/a
8 TRCN0000142364 GCTTCGGTGAACAAAGAGAAC pLKO.1 411 CDS 100% 4.050 2.835 N FAM110D n/a
9 TRCN0000142194 GTGAACAAAGAGAACGCCAAG pLKO.1 417 CDS 100% 2.250 1.575 N FAM110D n/a
10 TRCN0000142001 GAGATGAGCAAACCTGCTGAA pLKO.1 1185 3UTR 100% 4.050 2.430 N FAM110D n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1717 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2438 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2306 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2438 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08988 pDONR223 100% 99.8% 100% None 237G>A n/a
2 ccsbBroad304_08988 pLX_304 0% 99.8% 100% V5 237G>A n/a
3 TRCN0000481540 ATTGGGGCATGCCGCAGCAGTCAT pLX_317 52.1% 99.7% 99.6% V5 237G>A;811G>C n/a
Download CSV