Transcript: Human NM_024953.4

Homo sapiens N(alpha)-acetyltransferase 25, NatB auxiliary subunit (NAA25), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NAA25 (80018)
Length:
5771
CDS:
11..2929

Additional Resources:

NCBI RefSeq record:
NM_024953.4
NBCI Gene record:
NAA25 (80018)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024953.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415698 GAGGACCACATCTAGCTAAAT pLKO_005 972 CDS 100% 13.200 18.480 N NAA25 n/a
2 TRCN0000433538 TTACGAAGTCAAGGTTGTAAC pLKO_005 1010 CDS 100% 10.800 15.120 N NAA25 n/a
3 TRCN0000178593 CGGCCCATTTACGATTATCTT pLKO.1 56 CDS 100% 5.625 7.875 N Naa25 n/a
4 TRCN0000424418 GCAACAAGAGAACCCTACTTT pLKO_005 3177 3UTR 100% 5.625 7.875 N NAA25 n/a
5 TRCN0000004985 CCAGCATGATACCATTGGTTA pLKO.1 1621 CDS 100% 4.950 6.930 N NAA25 n/a
6 TRCN0000004983 CCGGATTGATATTCTTCGTTT pLKO.1 2176 CDS 100% 4.950 6.930 N NAA25 n/a
7 TRCN0000416503 GAATAGCCCTTCCATTATAAA pLKO_005 3295 3UTR 100% 15.000 10.500 N NAA25 n/a
8 TRCN0000004984 GCAGATAAACTGTTGAAGAAA pLKO.1 110 CDS 100% 5.625 3.938 N NAA25 n/a
9 TRCN0000004982 GCCTGTTTAAGATGGAACTTT pLKO.1 4661 3UTR 100% 5.625 3.938 N NAA25 n/a
10 TRCN0000004986 GCTGTGAAGTTTATAGAAGAT pLKO.1 914 CDS 100% 4.950 3.465 N NAA25 n/a
11 TRCN0000426689 CCACCTGTCTTTACCAGTTTC pLKO_005 2660 CDS 100% 10.800 6.480 N NAA25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024953.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.