Transcript: Human NM_024954.5

Homo sapiens ubiquitin domain containing 1 (UBTD1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
UBTD1 (80019)
Length:
1647
CDS:
281..964

Additional Resources:

NCBI RefSeq record:
NM_024954.5
NBCI Gene record:
UBTD1 (80019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024954.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022440 CCTCTGTGAATGCTACGATGA pLKO.1 583 CDS 100% 4.050 5.670 N UBTD1 n/a
2 TRCN0000022443 ACCCTCTGTGAATGCTACGAT pLKO.1 581 CDS 100% 3.000 4.200 N UBTD1 n/a
3 TRCN0000422314 TGCCTTCCAGTGCTGTCATTT pLKO_005 1025 3UTR 100% 13.200 9.240 N UBTD1 n/a
4 TRCN0000422792 CCTGAAGAAAGAGCGGCTTAA pLKO_005 364 CDS 100% 10.800 7.560 N UBTD1 n/a
5 TRCN0000413916 CCTTGCAACCTTGTCAGAGAA pLKO_005 1163 3UTR 100% 4.950 3.465 N UBTD1 n/a
6 TRCN0000200268 CATCCAGGTCATCATCAACCA pLKO.1 922 CDS 100% 2.640 1.848 N Ubtd1 n/a
7 TRCN0000022442 ATCGTGGCAGCGGTGGTTCTT pLKO.1 838 CDS 100% 1.650 1.155 N UBTD1 n/a
8 TRCN0000022441 CTGCCCATCTACTGCCTGTCA pLKO.1 623 CDS 100% 0.880 0.616 N UBTD1 n/a
9 TRCN0000022439 ATTGGCAGAGATGAGGCGGGT pLKO.1 1469 3UTR 100% 0.180 0.108 N UBTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024954.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04166 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04166 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469296 AGACCAATTCCTCTCTACAACCCA pLX_317 61.9% 100% 100% V5 n/a
Download CSV