Transcript: Human NM_025029.5

Homo sapiens mitotic spindle organizing protein 2B (MZT2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MZT2B (80097)
Length:
599
CDS:
22..498

Additional Resources:

NCBI RefSeq record:
NM_025029.5
NBCI Gene record:
MZT2B (80097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025029.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283710 AGACCCGAGGGAGAAACAAAG pLKO_005 332 CDS 100% 10.800 6.480 N MZT2B n/a
2 TRCN0000370973 GAAGGATCCAGCCAGAGGATG pLKO_005 403 CDS 100% 1.350 0.810 N MZT2B n/a
3 TRCN0000370974 AGAAACAAAGGCAGCGCTGCC pLKO_005 343 CDS 100% 0.400 0.240 N MZT2B n/a
4 TRCN0000269637 CCGTCTTCCAGATGCTCAAGT pLKO_005 233 CDS 100% 4.950 2.475 Y MZT2A n/a
5 TRCN0000370962 CCAGATGCTCAAGTCCATGTG pLKO_005 240 CDS 100% 4.050 2.025 Y MZT2B n/a
6 TRCN0000269638 ATGCTCAAGTCCATGTGTGCC pLKO_005 244 CDS 100% 2.160 1.080 Y MZT2A n/a
7 TRCN0000371012 CGACGTGTTCAAGATCCTGGT pLKO_005 180 CDS 100% 2.160 1.080 Y MZT2B n/a
8 TRCN0000269639 GACGTGTTCAAGATCCTGGTG pLKO_005 181 CDS 100% 2.160 1.080 Y MZT2A n/a
9 TRCN0000284056 ACCGAGGAGATGGAGCTGTAC pLKO_005 124 CDS 100% 1.350 0.675 Y MZT2A n/a
10 TRCN0000283713 CACCGAGGAGATGGAGCTGTA pLKO_005 123 CDS 100% 1.350 0.675 Y MZT2B n/a
11 TRCN0000370961 GTGGACCTGCTGAAGCTGAAC pLKO_005 199 CDS 100% 1.350 0.675 Y MZT2B n/a
12 TRCN0000370914 CCCTCGCCGTCTTCCAGATGC pLKO_005 227 CDS 100% 0.000 0.000 Y MZT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025029.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04172 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04172 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480888 AGGCTGACATTGAAGACGACCGTA pLX_317 85.8% 100% 100% V5 n/a
4 ccsbBroadEn_16169 pDONR223 0% 74.6% 72.7% None (many diffs) n/a
5 ccsbBroad304_16169 pLX_304 0% 74.6% 72.7% V5 (many diffs) n/a
6 TRCN0000470189 ATCGGAGGTTAAGTGCCTATTGCC pLX_317 77.5% 74.6% 72.7% V5 (many diffs) n/a
Download CSV