Transcript: Human NM_025112.5

Homo sapiens ZXD family zinc finger C (ZXDC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ZXDC (79364)
Length:
3377
CDS:
27..2603

Additional Resources:

NCBI RefSeq record:
NM_025112.5
NBCI Gene record:
ZXDC (79364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245357 AGAAGTTCACTACGGTCTATA pLKO_005 766 CDS 100% 13.200 18.480 N ZXDC n/a
2 TRCN0000245359 GTGCAGCAAGCAGTATGATAA pLKO_005 1028 CDS 100% 13.200 18.480 N ZXDC n/a
3 TRCN0000117795 CCATTCAACTAGCCAAGGAAA pLKO.1 2188 CDS 100% 4.950 6.930 N ZXDC n/a
4 TRCN0000245358 CGGCTGTGAGAAGACATTTAT pLKO_005 932 CDS 100% 15.000 10.500 N ZXDC n/a
5 TRCN0000245361 GCCCTCTTCCCAGACTAAATT pLKO_005 3210 3UTR 100% 15.000 10.500 N ZXDC n/a
6 TRCN0000245360 TGACGATGACCGGAGGTTTAC pLKO_005 1172 CDS 100% 10.800 7.560 N ZXDC n/a
7 TRCN0000117793 CCTCACAGTCTACTCAGAGAA pLKO.1 2242 CDS 100% 4.950 3.465 N ZXDC n/a
8 TRCN0000117796 GCAGTCTGTACATTCACTCTA pLKO.1 1324 CDS 100% 4.950 3.465 N ZXDC n/a
9 TRCN0000117794 CCTGCTAATAATAGCTCCCTA pLKO.1 1686 CDS 100% 2.640 1.848 N ZXDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12561 pDONR223 100% 45.5% 45.5% None 1_1401del n/a
2 ccsbBroad304_12561 pLX_304 0% 45.5% 45.5% V5 1_1401del n/a
3 TRCN0000466658 GCCTGGATCCAGAGTTGCCCCGTC pLX_317 38.4% 45.5% 45.5% V5 1_1401del n/a
Download CSV