Transcript: Human NM_025161.6

Homo sapiens FA core complex associated protein 100 (FAAP100), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAAP100 (80233)
Length:
3597
CDS:
24..2669

Additional Resources:

NCBI RefSeq record:
NM_025161.6
NBCI Gene record:
FAAP100 (80233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025161.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425692 GGGTGAGTTTGTAACTGTTGC pLKO_005 3075 3UTR 100% 4.050 5.670 N FAAP100 n/a
2 TRCN0000429009 GGAGCAGAACGCTCATGAAAG pLKO_005 2801 3UTR 100% 10.800 7.560 N FAAP100 n/a
3 TRCN0000179027 CATCTCTGAGAGAGTGTCTTT pLKO.1 1415 CDS 100% 4.950 3.465 N FAAP100 n/a
4 TRCN0000181093 CCCAAATGCCCTTGTCAAGAT pLKO.1 824 CDS 100% 4.950 3.465 N FAAP100 n/a
5 TRCN0000179769 GAGCACAAAGCAGATTCTGAT pLKO.1 2837 3UTR 100% 4.950 3.465 N FAAP100 n/a
6 TRCN0000420622 CACGCTGTTCTACAGTCTCAG pLKO_005 1823 CDS 100% 4.050 2.835 N FAAP100 n/a
7 TRCN0000180513 GCAACATCTCTGAGAGAGTGT pLKO.1 1411 CDS 100% 2.640 1.848 N FAAP100 n/a
8 TRCN0000181006 GCTGTCTGGAATTGGCAACAT pLKO.1 1397 CDS 100% 4.950 2.970 N FAAP100 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025161.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12687 pDONR223 100% 26.3% 26.2% None (many diffs) n/a
2 ccsbBroad304_12687 pLX_304 0% 26.3% 26.2% V5 (many diffs) n/a
3 TRCN0000492296 GTTGTCGCTTCCGAATTAAACGAT pLX_317 67.4% 26.3% 26.2% V5 (many diffs) n/a
4 ccsbBroadEn_14283 pDONR223 100% 26.2% 26.1% None (many diffs) n/a
5 ccsbBroad304_14283 pLX_304 0% 26.2% 26.1% V5 (many diffs) n/a
6 TRCN0000471272 TTATTCATGACGGTGTGCATGCCT pLX_317 60% 26.2% 26.1% V5 (many diffs) n/a
Download CSV