Transcript: Human NM_025163.4

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class Z (PIGZ), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PIGZ (80235)
Length:
2688
CDS:
148..1887

Additional Resources:

NCBI RefSeq record:
NM_025163.4
NBCI Gene record:
PIGZ (80235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416259 TCTTGCACTACAACCTGAATC pLKO_005 1034 CDS 100% 10.800 7.560 N PIGZ n/a
2 TRCN0000035307 TGCTGGTATCCTCCCATGTAA pLKO.1 716 CDS 100% 5.625 3.938 N PIGZ n/a
3 TRCN0000437782 CCCAAGACTCAGCCATAGAAG pLKO_005 1910 3UTR 100% 4.950 3.465 N PIGZ n/a
4 TRCN0000035304 CCCTTCAAGAATGAAACACTT pLKO.1 1756 CDS 100% 4.950 3.465 N PIGZ n/a
5 TRCN0000035305 CTGGGACATCATTCCAGGTTT pLKO.1 185 CDS 100% 4.950 3.465 N PIGZ n/a
6 TRCN0000035308 CCCGCTACATCCAGGAACCTT pLKO.1 994 CDS 100% 1.000 0.700 N PIGZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12688 pDONR223 100% 99.6% 99.4% None (many diffs) n/a
2 ccsbBroad304_12688 pLX_304 0% 99.6% 99.4% V5 (many diffs) n/a
3 TRCN0000471586 GGCACCGCGCGAGCTTCCGGTAAT pLX_317 22.4% 99.6% 99.4% V5 (many diffs) n/a
4 TRCN0000491706 TATAGGGTCCGGACAACGGTTAAC pLX_317 18.5% 99.6% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV