Transcript: Human NM_025181.5

Homo sapiens solute carrier family 35 member F5 (SLC35F5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC35F5 (80255)
Length:
10314
CDS:
234..1805

Additional Resources:

NCBI RefSeq record:
NM_025181.5
NBCI Gene record:
SLC35F5 (80255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025181.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043867 CTGAACTTACTTCGTATGTTT pLKO.1 493 CDS 100% 5.625 7.875 N SLC35F5 n/a
2 TRCN0000043863 CGCATGTCATATCCTGTGAAA pLKO.1 882 CDS 100% 4.950 6.930 N SLC35F5 n/a
3 TRCN0000043865 GCACACTTGCACTAAGCCTTA pLKO.1 1513 CDS 100% 4.050 5.670 N SLC35F5 n/a
4 TRCN0000430427 TCGTGTGAGGTTCAGTAATAT pLKO_005 809 CDS 100% 15.000 12.000 N SLC35F5 n/a
5 TRCN0000043864 GCAGGAGCTATCCCTGTATTT pLKO.1 1599 CDS 100% 13.200 9.240 N SLC35F5 n/a
6 TRCN0000435364 CAGATGCTGAAGGTTACTTTG pLKO_005 655 CDS 100% 10.800 7.560 N SLC35F5 n/a
7 TRCN0000422602 CCAGTATTTCTGACAGGTAAA pLKO_005 2208 3UTR 100% 10.800 7.560 N SLC35F5 n/a
8 TRCN0000043866 CCTGTGAAATTCCATGATCTT pLKO.1 732 CDS 100% 4.950 3.465 N SLC35F5 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9182 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9182 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6533 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9180 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9180 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9180 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6533 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025181.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09022 pDONR223 100% 99.9% 100% None 1563A>C n/a
2 ccsbBroad304_09022 pLX_304 0% 99.9% 100% V5 1563A>C n/a
3 TRCN0000470941 TAGCAGGATTGGTCCTCGGCACAA pLX_317 28.3% 99.9% 100% V5 1563A>C n/a
Download CSV