Transcript: Human NM_025222.4

Homo sapiens WD repeat domain 82 (WDR82), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
WDR82 (80335)
Length:
4286
CDS:
289..1230

Additional Resources:

NCBI RefSeq record:
NM_025222.4
NBCI Gene record:
WDR82 (80335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025222.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330681 GAATGGAGAGAGCGGTATAAA pLKO_005 1086 CDS 100% 15.000 21.000 N WDR82 n/a
2 TRCN0000128304 GCGTATGCATATATCTCTCAT pLKO.1 2366 3UTR 100% 4.950 6.930 N WDR82 n/a
3 TRCN0000330679 GCGTATGCATATATCTCTCAT pLKO_005 2366 3UTR 100% 4.950 6.930 N WDR82 n/a
4 TRCN0000130689 CGTACACCTTTCCCAAATGTA pLKO.1 3151 3UTR 100% 5.625 4.500 N WDR82 n/a
5 TRCN0000129877 GAAGCAAAGCTGATAGTGTTT pLKO.1 2518 3UTR 100% 4.950 3.960 N WDR82 n/a
6 TRCN0000330756 GAAGCAAAGCTGATAGTGTTT pLKO_005 2518 3UTR 100% 4.950 3.960 N WDR82 n/a
7 TRCN0000251142 TTTGATCCAGAAGGGTTAATT pLKO_005 751 CDS 100% 15.000 10.500 N Wdr82 n/a
8 TRCN0000330747 TTTGATCCAGAAGGGTTAATT pLKO_005 751 CDS 100% 15.000 10.500 N WDR82 n/a
9 TRCN0000130791 GAAGACTGAAGCAAAGCTGAT pLKO.1 2511 3UTR 100% 4.050 2.835 N WDR82 n/a
10 TRCN0000127796 GTTTCCAAGAGTTCAGCTGAA pLKO.1 2392 3UTR 100% 4.050 2.835 N WDR82 n/a
11 TRCN0000330680 GTTTCCAAGAGTTCAGCTGAA pLKO_005 2392 3UTR 100% 4.050 2.835 N WDR82 n/a
12 TRCN0000127699 GCAAAGCTGATAGTGTTTGCT pLKO.1 2521 3UTR 100% 0.300 0.210 N WDR82 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3498 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3498 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3663 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3496 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3496 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3496 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025222.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.