Transcript: Mouse NM_025278.5

Mus musculus guanine nucleotide binding protein (G protein), gamma 12 (Gng12), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gng12 (14701)
Length:
4259
CDS:
269..487

Additional Resources:

NCBI RefSeq record:
NM_025278.5
NBCI Gene record:
Gng12 (14701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025278.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311499 ACACCCTTCTCTCGGAATAAT pLKO_005 584 3UTR 100% 15.000 12.000 N Gng12 n/a
2 TRCN0000306315 ATGGGCATACCGACCTCAGAA pLKO_005 428 CDS 100% 4.950 3.960 N Gng12 n/a
3 TRCN0000037053 CGTTCAAGGATAAGAAGACCT pLKO.1 453 CDS 100% 2.640 2.112 N Gng12 n/a
4 TRCN0000326483 CGTTCAAGGATAAGAAGACCT pLKO_005 453 CDS 100% 2.640 2.112 N Gng12 n/a
5 TRCN0000037051 GAAGACCTGCATCATCTTATA pLKO.1 466 CDS 100% 13.200 9.240 N Gng12 n/a
6 TRCN0000326408 GAAGACCTGCATCATCTTATA pLKO_005 466 CDS 100% 13.200 9.240 N Gng12 n/a
7 TRCN0000037050 GAAGCCTCCATCGAAAGAATA pLKO.1 338 CDS 100% 13.200 9.240 N Gng12 n/a
8 TRCN0000037049 CGAAAGAATAAAGGTCTCAAA pLKO.1 349 CDS 100% 4.950 3.465 N Gng12 n/a
9 TRCN0000037052 GCTGAGATTGGAAGCCTCCAT pLKO.1 328 CDS 100% 2.640 1.848 N Gng12 n/a
10 TRCN0000326481 GCTGAGATTGGAAGCCTCCAT pLKO_005 328 CDS 100% 2.640 1.848 N Gng12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025278.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08615 pDONR223 100% 86.1% 95.8% None (many diffs) n/a
2 ccsbBroad304_08615 pLX_304 0% 86.1% 95.8% V5 (many diffs) n/a
3 TRCN0000465877 AACAGAGGGTGCTGCATACATATC pLX_317 100% 86.1% 95.8% V5 (many diffs) n/a
Download CSV