Transcript: Mouse NM_025290.3

Mus musculus radial spoke head 1 homolog (Chlamydomonas) (Rsph1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rsph1 (22092)
Length:
1164
CDS:
102..1007

Additional Resources:

NCBI RefSeq record:
NM_025290.3
NBCI Gene record:
Rsph1 (22092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426922 CCGTCAGACCTCCAGGATTAA pLKO_005 987 CDS 100% 13.200 10.560 N Rsph1 n/a
2 TRCN0000432736 GGAGTGGTTCAATCATCAAAG pLKO_005 446 CDS 100% 10.800 8.640 N Rsph1 n/a
3 TRCN0000078750 GTATTTGATATTGGATGCGAA pLKO.1 624 CDS 100% 2.640 2.112 N Rsph1 n/a
4 TRCN0000446281 GCCAAGGCACCTTTATCTATC pLKO_005 334 CDS 100% 10.800 7.560 N Rsph1 n/a
5 TRCN0000078749 GAGACATTAGTGAACATCGTT pLKO.1 702 CDS 100% 3.000 2.100 N Rsph1 n/a
6 TRCN0000078752 GCTACGACATAGACCAGGGAA pLKO.1 946 CDS 100% 2.640 1.848 N Rsph1 n/a
7 TRCN0000078751 CTATGTCAACAATGACACCTA pLKO.1 419 CDS 100% 0.264 0.185 N Rsph1 n/a
8 TRCN0000078748 CAGACACACCAGGCGTGCCTT pLKO.1 1029 3UTR 100% 0.000 0.000 N Rsph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025290.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04490 pDONR223 100% 77% 76.8% None (many diffs) n/a
2 ccsbBroad304_04490 pLX_304 0% 77% 76.8% V5 (many diffs) n/a
3 TRCN0000478133 ATTTGCTCCAATCACCCGAGGAGT pLX_317 44.9% 76.9% 63.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV