Transcript: Mouse NM_025374.3

Mus musculus glyoxalase 1 (Glo1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Glo1 (109801)
Length:
1958
CDS:
109..663

Additional Resources:

NCBI RefSeq record:
NM_025374.3
NBCI Gene record:
Glo1 (109801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328461 CTCGTGGATTTGGTCACATTG pLKO_005 473 CDS 100% 10.800 15.120 N Glo1 n/a
2 TRCN0000114844 GAGATTCTGAATCCTAACAAA pLKO.1 625 CDS 100% 5.625 7.875 N Glo1 n/a
3 TRCN0000328398 GAGATTCTGAATCCTAACAAA pLKO_005 625 CDS 100% 5.625 7.875 N Glo1 n/a
4 TRCN0000114845 CTCGCTCTACTTCTTAGCTTA pLKO.1 312 CDS 100% 4.950 6.930 N Glo1 n/a
5 TRCN0000328459 CTCGCTCTACTTCTTAGCTTA pLKO_005 312 CDS 100% 4.950 6.930 N Glo1 n/a
6 TRCN0000114842 GCAGCAAACGATGCTAAGAAT pLKO.1 204 CDS 100% 5.625 3.938 N Glo1 n/a
7 TRCN0000328458 GCAGCAAACGATGCTAAGAAT pLKO_005 204 CDS 100% 5.625 3.938 N Glo1 n/a
8 TRCN0000114841 CCTCAGAAATAACTTTCCATA pLKO.1 1073 3UTR 100% 4.950 3.465 N Glo1 n/a
9 TRCN0000114843 CGAGACTCAGAGTTACCACAA pLKO.1 438 CDS 100% 4.050 2.835 N Glo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00646 pDONR223 100% 82.4% 90.2% None (many diffs) n/a
2 ccsbBroad304_00646 pLX_304 0% 82.4% 90.2% V5 (many diffs) n/a
3 TRCN0000467773 ACGCCGAGATCCGCATAAGCCGTA pLX_317 23.9% 82.4% 90.2% V5 (many diffs) n/a
Download CSV