Transcript: Mouse NM_025380.2

Mus musculus eukaryotic translation elongation factor 1 epsilon 1 (Eef1e1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Eef1e1 (66143)
Length:
1039
CDS:
36..560

Additional Resources:

NCBI RefSeq record:
NM_025380.2
NBCI Gene record:
Eef1e1 (66143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098843 CGCTTTATAGTTGACCTGACA pLKO.1 411 CDS 100% 2.640 3.696 N Eef1e1 n/a
2 TRCN0000308446 CGCTTTATAGTTGACCTGACA pLKO_005 411 CDS 100% 2.640 3.696 N Eef1e1 n/a
3 TRCN0000098840 CCTGTAGTTGAGGCTTCGTAA pLKO.1 708 3UTR 100% 4.950 3.465 N Eef1e1 n/a
4 TRCN0000308447 CCTGTAGTTGAGGCTTCGTAA pLKO_005 708 3UTR 100% 4.950 3.465 N Eef1e1 n/a
5 TRCN0000098841 CGAGTCTAATGGGATTGAGTA pLKO.1 151 CDS 100% 4.950 3.465 N Eef1e1 n/a
6 TRCN0000098842 CTGAAGGATCTTAATTCCTAT pLKO.1 318 CDS 100% 4.950 3.465 N Eef1e1 n/a
7 TRCN0000308445 CTGAAGGATCTTAATTCCTAT pLKO_005 318 CDS 100% 4.950 3.465 N Eef1e1 n/a
8 TRCN0000098844 CTTGAAGATAAAGTCTACCTT pLKO.1 339 CDS 100% 3.000 2.100 N Eef1e1 n/a
9 TRCN0000308371 CTTGAAGATAAAGTCTACCTT pLKO_005 339 CDS 100% 3.000 2.100 N Eef1e1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025380.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475519 CAGTTGGGAACGCAGAATCGGATT pLX_317 68% 86.5% 88.5% V5 (many diffs) n/a
2 ccsbBroadEn_14021 pDONR223 100% 86.3% 86.2% None (many diffs) n/a
3 ccsbBroad304_14021 pLX_304 0% 86.3% 86.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV