Transcript: Mouse NM_025449.3

Mus musculus nicolin 1 (Nicn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nicn1 (66257)
Length:
2103
CDS:
75..716

Additional Resources:

NCBI RefSeq record:
NM_025449.3
NBCI Gene record:
Nicn1 (66257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276792 CATCCGTGTTCGTCAACAAAG pLKO_005 251 CDS 100% 10.800 15.120 N Nicn1 n/a
2 TRCN0000193222 CAGGAGATCATGTTTAAGAAT pLKO.1 210 CDS 100% 5.625 7.875 N Nicn1 n/a
3 TRCN0000276794 CAGGAGATCATGTTTAAGAAT pLKO_005 210 CDS 100% 5.625 7.875 N Nicn1 n/a
4 TRCN0000194222 GCAGGAGATCATGTTTAAGAA pLKO.1 209 CDS 100% 5.625 7.875 N Nicn1 n/a
5 TRCN0000276746 GAGGAAGACATACCCTCTATT pLKO_005 1087 3UTR 100% 13.200 9.240 N Nicn1 n/a
6 TRCN0000285647 GGTAACTTGTCTTCGGGATTA pLKO_005 296 CDS 100% 10.800 7.560 N Nicn1 n/a
7 TRCN0000173486 GAGTTGCAGGAGATCATGTTT pLKO.1 204 CDS 100% 5.625 3.938 N Nicn1 n/a
8 TRCN0000176009 GATGGCTGTTATGATCTGAAT pLKO.1 678 CDS 100% 4.950 3.465 N Nicn1 n/a
9 TRCN0000276793 GATGGCTGTTATGATCTGAAT pLKO_005 678 CDS 100% 4.950 3.465 N Nicn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04354 pDONR223 100% 86.5% 89.2% None (many diffs) n/a
2 ccsbBroad304_04354 pLX_304 0% 86.5% 89.2% V5 (many diffs) n/a
3 TRCN0000473466 TAACTGAGGCGCGGAGGGACCGAC pLX_317 68.5% 86.5% 89.2% V5 (many diffs) n/a
Download CSV