Transcript: Mouse NM_025476.6

Mus musculus regulator of microtubule dynamics 1 (Rmdn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rmdn1 (66302)
Length:
1875
CDS:
149..1066

Additional Resources:

NCBI RefSeq record:
NM_025476.6
NBCI Gene record:
Rmdn1 (66302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025476.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191985 GCAACAACATACCTAATACTT pLKO.1 1093 3UTR 100% 5.625 4.500 N Rmdn1 n/a
2 TRCN0000319812 GCAACAACATACCTAATACTT pLKO_005 1093 3UTR 100% 5.625 4.500 N Rmdn1 n/a
3 TRCN0000201727 GCGAGGTGATAGGAAATACAA pLKO.1 258 CDS 100% 5.625 4.500 N Rmdn1 n/a
4 TRCN0000319876 GCGAGGTGATAGGAAATACAA pLKO_005 258 CDS 100% 5.625 4.500 N Rmdn1 n/a
5 TRCN0000146666 CTTCAATTCACCTTATGGGTA pLKO.1 750 CDS 100% 2.640 2.112 N RMDN1 n/a
6 TRCN0000312471 CTTCAATTCACCTTATGGGTA pLKO_005 750 CDS 100% 2.640 2.112 N RMDN1 n/a
7 TRCN0000192505 GCAATCTGCATTAGTGATGTT pLKO.1 635 CDS 100% 4.950 3.465 N Rmdn1 n/a
8 TRCN0000319877 GCAATCTGCATTAGTGATGTT pLKO_005 635 CDS 100% 4.950 3.465 N Rmdn1 n/a
9 TRCN0000189931 GCCACAGCCAAAGTTGAAGAA pLKO.1 368 CDS 100% 4.950 3.465 N Rmdn1 n/a
10 TRCN0000319811 GCCACAGCCAAAGTTGAAGAA pLKO_005 368 CDS 100% 4.950 3.465 N Rmdn1 n/a
11 TRCN0000148382 CCTTATGGGTATTTGGTGCTA pLKO.1 760 CDS 100% 2.640 1.848 N RMDN1 n/a
12 TRCN0000312419 CCTTATGGGTATTTGGTGCTA pLKO_005 760 CDS 100% 2.640 1.848 N RMDN1 n/a
13 TRCN0000148167 GATGCTACTTCAATTCACCTT pLKO.1 743 CDS 100% 2.640 1.848 N RMDN1 n/a
14 TRCN0000148289 CCCTAAAGATGCTACTTCAAT pLKO.1 736 CDS 100% 5.625 3.375 N RMDN1 n/a
15 TRCN0000312417 CCCTAAAGATGCTACTTCAAT pLKO_005 736 CDS 100% 5.625 3.375 N RMDN1 n/a
16 TRCN0000166873 CACATAAACATGGAAGTACAT pLKO.1 1852 3UTR 100% 4.950 3.960 N LOC441242 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025476.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03214 pDONR223 100% 84.4% 81.5% None (many diffs) n/a
Download CSV