Transcript: Mouse NM_025551.3

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (Ndufa12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ndufa12 (66414)
Length:
561
CDS:
25..474

Additional Resources:

NCBI RefSeq record:
NM_025551.3
NBCI Gene record:
Ndufa12 (66414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197521 CAGAGCAATACGTTCCTTATT pLKO.1 398 CDS 100% 13.200 18.480 N Ndufa12 n/a
2 TRCN0000198180 CGACTGCTCGTAAATTCATCT pLKO.1 344 CDS 100% 4.950 6.930 N Ndufa12 n/a
3 TRCN0000292945 CGACTGCTCGTAAATTCATCT pLKO_005 344 CDS 100% 4.950 6.930 N Ndufa12 n/a
4 TRCN0000215830 CTTCAGGGCAAATGATATAAG pLKO.1 117 CDS 100% 13.200 10.560 N Ndufa12 n/a
5 TRCN0000198179 CTGGTGGGAGAAGACAAATAT pLKO.1 148 CDS 100% 15.000 10.500 N Ndufa12 n/a
6 TRCN0000176775 CTACGAAGACAACAAGCAATT pLKO.1 180 CDS 100% 10.800 7.560 N Ndufa12 n/a
7 TRCN0000293005 CTACGAAGACAACAAGCAATT pLKO_005 180 CDS 100% 10.800 7.560 N Ndufa12 n/a
8 TRCN0000176776 CTGGACAAACCATAAATTCAA pLKO.1 363 CDS 100% 5.625 3.938 N Ndufa12 n/a
9 TRCN0000293004 CTGGACAAACCATAAATTCAA pLKO_005 363 CDS 100% 5.625 3.938 N Ndufa12 n/a
10 TRCN0000215596 GATATAAGGATTGGTACACTG pLKO.1 130 CDS 100% 4.050 2.835 N Ndufa12 n/a
11 TRCN0000215507 GGAAATAAATACTACGAAGAC pLKO.1 169 CDS 100% 4.050 2.835 N Ndufa12 n/a
12 TRCN0000182091 CTCCAGAGCAATACGTTCCTT pLKO.1 395 CDS 100% 3.000 2.100 N Ndufa12 n/a
13 TRCN0000310079 CTCCAGAGCAATACGTTCCTT pLKO_005 395 CDS 100% 3.000 2.100 N Ndufa12 n/a
14 TRCN0000438178 ATGTGGATGGAAGCATGGTGC pLKO_005 263 CDS 100% 2.160 1.512 N NDUFA12 n/a
15 TRCN0000418750 ACCACTAGAAAGAAGATTCAG pLKO_005 421 CDS 100% 4.950 3.465 N NDUFA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08614 pDONR223 100% 83.4% 85.9% None (many diffs) n/a
2 ccsbBroad304_08614 pLX_304 0% 83.4% 85.9% V5 (many diffs) n/a
3 TRCN0000467143 CTGAGTATGAATGCTAATCGCCCT pLX_317 93.8% 83.4% 85.9% V5 (many diffs) n/a
Download CSV