Transcript: Mouse NM_025563.3

Mus musculus BLOC-1 related complex subunit 7 (Borcs7), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Borcs7 (66439)
Length:
2176
CDS:
43..360

Additional Resources:

NCBI RefSeq record:
NM_025563.3
NBCI Gene record:
Borcs7 (66439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182727 GCCATCTTACACTCGGAAGAT pLKO.1 223 CDS 100% 0.495 0.693 N Borcs7 n/a
2 TRCN0000215536 GGTTGAATCATTAGCACTAAA pLKO.1 675 3UTR 100% 13.200 9.240 N Borcs7 n/a
3 TRCN0000198832 CTACAGGAAGATGCCATCTTA pLKO.1 211 CDS 100% 5.625 3.938 N Borcs7 n/a
4 TRCN0000128243 GCAAGAAGCTATTCAGAAGAA pLKO.1 288 CDS 100% 4.950 3.465 N BORCS7 n/a
5 TRCN0000182442 GCAGCTCGAAACATGGTACTA pLKO.1 193 CDS 100% 4.950 3.465 N Borcs7 n/a
6 TRCN0000177237 GCAATAATAACAACACACCTT pLKO.1 259 CDS 100% 2.640 1.848 N Borcs7 n/a
7 TRCN0000216800 GTACCAGCAAGAAGCTATTCA pLKO.1 282 CDS 100% 0.000 0.000 N Borcs7 n/a
8 TRCN0000181746 GCCTCTCAACTATTGGGATTA pLKO.1 888 3UTR 100% 10.800 6.480 N Borcs7 n/a
9 TRCN0000198665 CCAGTTGAGTCACTTACTGAA pLKO.1 336 CDS 100% 4.950 2.970 N Borcs7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13073 pDONR223 100% 90.1% 96.1% None (many diffs) n/a
2 ccsbBroad304_13073 pLX_304 0% 90.1% 96.1% V5 (many diffs) n/a
3 TRCN0000466605 GGGCATGATAGTAGCACCACATAC pLX_317 100% 90.1% 96.1% V5 (many diffs) n/a
Download CSV