Transcript: Mouse NM_025681.2

Mus musculus limb and CNS expressed 1 (Lix1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lix1 (66643)
Length:
3124
CDS:
260..1108

Additional Resources:

NCBI RefSeq record:
NM_025681.2
NBCI Gene record:
Lix1 (66643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191578 GTTGTGTCAATGTTACAGGAA pLKO.1 347 CDS 100% 2.640 2.112 N Lix1 n/a
2 TRCN0000192725 GACGTTCACATCAGGAATCTA pLKO.1 1135 3UTR 100% 5.625 2.813 Y Lix1 n/a
3 TRCN0000200617 CTGACAGAAGTTGTTAGAGAT pLKO.1 1157 3UTR 100% 4.950 2.475 Y Lix1 n/a
4 TRCN0000201078 CTGTGTGGCTATCATTAGCAA pLKO.1 1091 CDS 100% 3.000 1.500 Y Lix1 n/a
5 TRCN0000201539 CGTGAAACAAAGTGCTCTCGA pLKO.1 797 CDS 100% 2.640 1.320 Y Lix1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492018 CCTCCCCTTCTTATTATAAGGAAC pLX_317 39.6% 90% 94.6% V5 (many diffs) n/a
2 ccsbBroadEn_09767 pDONR223 100% 89.9% 94.3% None (many diffs) n/a
3 ccsbBroad304_09767 pLX_304 0% 89.9% 94.3% V5 (many diffs) n/a
Download CSV