Transcript: Mouse NM_025711.3

Mus musculus asporin (Aspn), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Aspn (66695)
Length:
2362
CDS:
299..1420

Additional Resources:

NCBI RefSeq record:
NM_025711.3
NBCI Gene record:
Aspn (66695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375557 AGAAATTGAGAAGGCTATATT pLKO_005 726 CDS 100% 15.000 21.000 N Aspn n/a
2 TRCN0000094163 GCTCTGCCAAACCCTTCTTTA pLKO.1 336 CDS 100% 13.200 9.240 N Aspn n/a
3 TRCN0000352111 GCTCTGCCAAACCCTTCTTTA pLKO_005 336 CDS 100% 13.200 9.240 N Aspn n/a
4 TRCN0000094159 GCTTCAAGTATTCACAGATAA pLKO.1 1915 3UTR 100% 13.200 9.240 N Aspn n/a
5 TRCN0000094161 GTTCCAAACAACATTCCATTT pLKO.1 563 CDS 100% 10.800 7.560 N Aspn n/a
6 TRCN0000352032 GTTCCAAACAACATTCCATTT pLKO_005 563 CDS 100% 10.800 7.560 N Aspn n/a
7 TRCN0000094162 CCTGCAACATTTCGTTGTGTT pLKO.1 1358 CDS 100% 4.950 3.465 N Aspn n/a
8 TRCN0000352033 CCTGCAACATTTCGTTGTGTT pLKO_005 1358 CDS 100% 4.950 3.465 N Aspn n/a
9 TRCN0000094160 CGGTTCCAAACAACATTCCAT pLKO.1 561 CDS 100% 3.000 2.100 N Aspn n/a
10 TRCN0000375613 GGTGGAACTTGAAGATCTTAA pLKO_005 1042 CDS 100% 13.200 7.920 N Aspn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12093 pDONR223 100% 87.1% 88.8% None (many diffs) n/a
2 TRCN0000477769 TGAAGACTACGTACATCTATATAA pLX_317 37.7% 87.1% 88.8% V5 (many diffs) n/a
Download CSV