Transcript: Mouse NM_025816.3

Mus musculus Tax1 (human T cell leukemia virus type I) binding protein 1 (Tax1bp1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tax1bp1 (52440)
Length:
3307
CDS:
135..2579

Additional Resources:

NCBI RefSeq record:
NM_025816.3
NBCI Gene record:
Tax1bp1 (52440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177826 CCATTACACCTTAACTCCGTA pLKO.1 236 CDS 100% 2.640 3.696 N Tax1bp1 n/a
2 TRCN0000200219 CGTCACCCATAAGGGTGAAAT pLKO.1 446 CDS 100% 1.320 1.848 N Tax1bp1 n/a
3 TRCN0000197823 GCTCGTGACTATTACACATTT pLKO.1 312 CDS 100% 13.200 10.560 N Tax1bp1 n/a
4 TRCN0000219583 TGCAGTGAATGTGCGAGATAA pLKO.1 1271 CDS 100% 13.200 9.240 N Tax1bp1 n/a
5 TRCN0000177399 GCTGTGACTACATACAATGAA pLKO.1 2734 3UTR 100% 5.625 3.938 N Tax1bp1 n/a
6 TRCN0000198119 CCTGATGATGGAGAACTTCTT pLKO.1 2682 3UTR 100% 4.950 3.465 N Tax1bp1 n/a
7 TRCN0000177400 GCCTTCTTGAAGTATCACAAA pLKO.1 748 CDS 100% 4.950 3.465 N Tax1bp1 n/a
8 TRCN0000177084 CTGTTAATCTTGTCTGCTGTA pLKO.1 2769 3UTR 100% 4.050 2.835 N Tax1bp1 n/a
9 TRCN0000200148 CAGTTCTGTTACGTCACCCAT pLKO.1 435 CDS 100% 2.640 1.848 N Tax1bp1 n/a
10 TRCN0000177717 CCAGCTTTGATGTTCACAAGA pLKO.1 2374 CDS 100% 4.950 2.970 N Tax1bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025816.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07325 pDONR223 100% 83.8% 84.1% None (many diffs) n/a
2 ccsbBroad304_07325 pLX_304 0% 83.8% 84.1% V5 (many diffs) n/a
Download CSV