Transcript: Mouse NM_025829.4

Mus musculus eukaryotic translation initiation factor 4E member 3 (Eif4e3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Eif4e3 (66892)
Length:
2513
CDS:
20..643

Additional Resources:

NCBI RefSeq record:
NM_025829.4
NBCI Gene record:
Eif4e3 (66892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191579 GAATTGTTGTTAGCGACCATT pLKO.1 389 CDS 100% 4.950 6.930 N Eif4e3 n/a
2 TRCN0000292917 GAATTGTTGTTAGCGACCATT pLKO_005 389 CDS 100% 4.950 6.930 N Eif4e3 n/a
3 TRCN0000192339 CGGTACAAACAGTGCAGATAT pLKO.1 201 CDS 100% 13.200 9.240 N Eif4e3 n/a
4 TRCN0000292916 CGGTACAAACAGTGCAGATAT pLKO_005 201 CDS 100% 13.200 9.240 N Eif4e3 n/a
5 TRCN0000191911 GCAGATATTCTGGAGTGTATA pLKO.1 214 CDS 100% 13.200 9.240 N Eif4e3 n/a
6 TRCN0000292919 GCAGATATTCTGGAGTGTATA pLKO_005 214 CDS 100% 13.200 9.240 N Eif4e3 n/a
7 TRCN0000200907 CGTGCATTTCTCTGAACAGTT pLKO.1 2220 3UTR 100% 4.950 3.465 N Eif4e3 n/a
8 TRCN0000298071 CGTGCATTTCTCTGAACAGTT pLKO_005 2220 3UTR 100% 4.950 3.465 N Eif4e3 n/a
9 TRCN0000148696 CCATGAAGAGCATCATGCTTT pLKO.1 598 CDS 100% 0.495 0.297 N EIF4E3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05420 pDONR223 100% 50.7% 55% None (many diffs) n/a
2 ccsbBroad304_05420 pLX_304 0% 50.7% 55% V5 (many diffs) n/a
3 TRCN0000480503 CTTCGCGTCTTCCTGCTTAGGGTG pLX_317 100% 50.7% 55% V5 (many diffs) n/a
Download CSV