Transcript: Mouse NM_025864.4

Mus musculus proton activated chloride channel 1 (Pacc1), mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Mus musculus (mouse)
Gene:
Pacc1 (66950)
Length:
2626
CDS:
140..1192

Additional Resources:

NCBI RefSeq record:
NM_025864.4
NBCI Gene record:
Pacc1 (66950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304773 ACCAGCGTGGTTAACTATATT pLKO_005 923 CDS 100% 15.000 21.000 N Pacc1 n/a
2 TRCN0000125303 GAAGCTGTTGAGTTCCGTCAA pLKO.1 899 CDS 100% 4.050 5.670 N Pacc1 n/a
3 TRCN0000331850 GAAGCTGTTGAGTTCCGTCAA pLKO_005 899 CDS 100% 4.050 5.670 N Pacc1 n/a
4 TRCN0000125302 GTGTCTTACAAGGAGGTGGAT pLKO.1 446 CDS 100% 2.640 3.696 N Pacc1 n/a
5 TRCN0000125300 GCACCACTCAGAGGATCAATT pLKO.1 585 CDS 100% 13.200 9.240 N Pacc1 n/a
6 TRCN0000302465 GCACCACTCAGAGGATCAATT pLKO_005 585 CDS 100% 13.200 9.240 N Pacc1 n/a
7 TRCN0000304774 TTGCCAAACTAAGCGTGAAAT pLKO_005 1107 CDS 100% 13.200 9.240 N Pacc1 n/a
8 TRCN0000125299 CCAGTGAATAACCTGAAACTT pLKO.1 1323 3UTR 100% 5.625 3.938 N Pacc1 n/a
9 TRCN0000302466 CCAGTGAATAACCTGAAACTT pLKO_005 1323 3UTR 100% 5.625 3.938 N Pacc1 n/a
10 TRCN0000125301 CAGGACATAATCACAGCCAAT pLKO.1 1025 CDS 100% 4.050 2.835 N Pacc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025864.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03561 pDONR223 100% 86.3% 90.5% None (many diffs) n/a
2 ccsbBroad304_03561 pLX_304 0% 86.3% 90.5% V5 (many diffs) n/a
3 TRCN0000467460 CCCAGTGGGGTCCGGGTCAACTCG pLX_317 41.7% 86.3% 90.5% V5 (many diffs) n/a
Download CSV