Transcript: Mouse NM_025895.4

Mus musculus mediator complex subunit 28 (Med28), mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
Med28 (66999)
Length:
4568
CDS:
98..634

Additional Resources:

NCBI RefSeq record:
NM_025895.4
NBCI Gene record:
Med28 (66999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313091 CCAGAAACCAGATCAAGTTAT pLKO_005 409 CDS 100% 13.200 18.480 N Med28 n/a
2 TRCN0000348219 CAGAAACCAGATCAAGTTATC pLKO_005 410 CDS 100% 10.800 8.640 N Med28 n/a
3 TRCN0000349861 ATCAGTTTCTGTCCCTATTTA pLKO_005 730 3UTR 100% 15.000 10.500 N Med28 n/a
4 TRCN0000127036 GATCAGTGTATCCAGAAGTTT pLKO.1 329 CDS 100% 5.625 3.938 N Med28 n/a
5 TRCN0000312110 GATCAGTGTATCCAGAAGTTT pLKO_005 329 CDS 100% 5.625 3.938 N Med28 n/a
6 TRCN0000127038 CTTCCCTTGTGAGTCAGGATT pLKO.1 267 CDS 100% 4.950 3.465 N Med28 n/a
7 TRCN0000127035 CGAGACCATCTAACAGCACTT pLKO.1 207 CDS 100% 4.050 2.835 N Med28 n/a
8 TRCN0000312056 CGAGACCATCTAACAGCACTT pLKO_005 207 CDS 100% 4.050 2.835 N Med28 n/a
9 TRCN0000127037 CACTTGACAAAGCTGAGGCAT pLKO.1 491 CDS 100% 2.640 1.848 N Med28 n/a
10 TRCN0000349362 CACTTGACAAAGCTGAGGCAT pLKO_005 491 CDS 100% 2.640 1.848 N Med28 n/a
11 TRCN0000127034 CCTATTTATAAGGTAGGGTTT pLKO.1 743 3UTR 100% 4.050 2.430 N Med28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025895.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04202 pDONR223 100% 88% 94.3% None (many diffs) n/a
2 ccsbBroad304_04202 pLX_304 0% 88% 94.3% V5 (many diffs) n/a
Download CSV