Transcript: Mouse NM_025898.3

Mus musculus N-ethylmaleimide sensitive fusion protein attachment protein alpha (Napa), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Napa (108124)
Length:
2332
CDS:
35..922

Additional Resources:

NCBI RefSeq record:
NM_025898.3
NBCI Gene record:
Napa (108124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295240 CCTTCACCCTGCCGTTTATTT pLKO_005 1069 3UTR 100% 15.000 21.000 N Napa n/a
2 TRCN0000029170 CAGCGCCAAAGACTACTTCTT pLKO.1 634 CDS 100% 4.950 6.930 N NAPA n/a
3 TRCN0000293265 CAGCGCCAAAGACTACTTCTT pLKO_005 634 CDS 100% 4.950 6.930 N NAPA n/a
4 TRCN0000111544 GCGCATAAAGAAGACCATTCA pLKO.1 877 CDS 100% 4.950 6.930 N Napa n/a
5 TRCN0000295307 AGGAAGCATGCGAGATCTATG pLKO_005 150 CDS 100% 10.800 8.640 N Napa n/a
6 TRCN0000381555 CCTGACCAGCAGTGTACTAAG pLKO_005 1196 3UTR 100% 10.800 8.640 N Napa n/a
7 TRCN0000380800 ACCATGCTTCTGCGCATAAAG pLKO_005 866 CDS 100% 13.200 9.240 N Napa n/a
8 TRCN0000295239 TGAGAGCAATTGAGATCTATA pLKO_005 348 CDS 100% 13.200 9.240 N Napa n/a
9 TRCN0000381787 AGCTCGCTGTTCAGAAGTATG pLKO_005 699 CDS 100% 10.800 7.560 N Napa n/a
10 TRCN0000111542 CGCTGGCAATGCTTTCAAGAA pLKO.1 295 CDS 100% 4.950 3.465 N Napa n/a
11 TRCN0000111540 GCTTCCTAAGTGGCTCAGATA pLKO.1 1927 3UTR 100% 4.950 3.465 N Napa n/a
12 TRCN0000111541 GCAGACTACTACAAAGGAGAA pLKO.1 479 CDS 100% 4.050 2.835 N Napa n/a
13 TRCN0000287879 GCAGACTACTACAAAGGAGAA pLKO_005 479 CDS 100% 4.050 2.835 N Napa n/a
14 TRCN0000111543 CGCCAAAGACTACTTCTTCAA pLKO.1 637 CDS 100% 4.950 2.970 N Napa n/a
15 TRCN0000298396 CGCCAAAGACTACTTCTTCAA pLKO_005 637 CDS 100% 4.950 2.970 N Napa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02014 pDONR223 100% 90.5% 98.3% None (many diffs) n/a
2 ccsbBroad304_02014 pLX_304 0% 90.5% 98.3% V5 (many diffs) n/a
3 TRCN0000472853 CTGTAGACAATTTAGACTTCCTCG pLX_317 46.2% 90.5% 98.3% V5 (many diffs) n/a
Download CSV