Transcript: Mouse NM_026017.2

Mus musculus CTD nuclear envelope phosphatase 1 (Ctdnep1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ctdnep1 (67181)
Length:
1615
CDS:
317..1051

Additional Resources:

NCBI RefSeq record:
NM_026017.2
NBCI Gene record:
Ctdnep1 (67181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215980 CAGTATCAGACTGTTCGATAT pLKO.1 425 CDS 100% 10.800 15.120 N Ctdnep1 n/a
2 TRCN0000247433 CCGAAACCTTCACCAACATAG pLKO_005 1021 CDS 100% 10.800 8.640 N Ctdnep1 n/a
3 TRCN0000247430 AGGCAGATCCGCACGGTAATT pLKO_005 404 CDS 100% 13.200 9.240 N Ctdnep1 n/a
4 TRCN0000247434 TCAGACTGTTCGATATGATAT pLKO_005 430 CDS 100% 13.200 9.240 N Ctdnep1 n/a
5 TRCN0000247431 TTCATCCTCAAGGTGGTAATA pLKO_005 593 CDS 100% 13.200 9.240 N Ctdnep1 n/a
6 TRCN0000247432 GGGTTCACACTCCGTGGAAAT pLKO_005 1250 3UTR 100% 10.800 7.560 N Ctdnep1 n/a
7 TRCN0000200585 CCAATTCAACTTTGTTGTGAT pLKO.1 1371 3UTR 100% 4.950 3.465 N Ctdnep1 n/a
8 TRCN0000006915 CCCATCAAATCCTGGTTCAGT pLKO.1 917 CDS 100% 3.000 2.100 N CTDNEP1 n/a
9 TRCN0000277824 CCCATCAAATCCTGGTTCAGT pLKO_005 917 CDS 100% 3.000 2.100 N CTDNEP1 n/a
10 TRCN0000192622 GCCAATTCAACTTTGTTGTGA pLKO.1 1370 3UTR 100% 3.000 2.100 N Ctdnep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07878 pDONR223 100% 93.5% 99.5% None (many diffs) n/a
2 ccsbBroad304_07878 pLX_304 0% 93.5% 99.5% V5 (many diffs) n/a
3 TRCN0000473862 CCCTGGAGGACGTGGTAGCTCGGC pLX_317 66.6% 93.5% 99.5% V5 (many diffs) n/a
Download CSV