Transcript: Mouse NM_026160.4

Mus musculus microtubule-associated protein 1 light chain 3 beta (Map1lc3b), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Map1lc3b (67443)
Length:
1712
CDS:
58..435

Additional Resources:

NCBI RefSeq record:
NM_026160.4
NBCI Gene record:
Map1lc3b (67443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428166 GAGACATTCGGGACAGCAATG pLKO_005 406 CDS 100% 6.000 4.800 N Map1lc3b n/a
2 TRCN0000429916 AGATAATCAGACGGCGCTTGC pLKO_005 251 CDS 100% 2.250 1.800 N Map1lc3b n/a
3 TRCN0000120797 GCATCCTAAGTTGCCAATAAA pLKO.1 669 3UTR 100% 15.000 10.500 N Map1lc3b n/a
4 TRCN0000419388 TGAGCGAGCTCATCAAGATAA pLKO_005 236 CDS 100% 13.200 9.240 N Map1lc3b n/a
5 TRCN0000120798 CCCAGTGATTATAGAGCGATA pLKO.1 150 CDS 100% 4.050 2.835 N Map1lc3b n/a
6 TRCN0000428832 TCTCCGAAGTGTACGAGAGTG pLKO_005 341 CDS 100% 4.050 2.835 N Map1lc3b n/a
7 TRCN0000120800 GCTCAATGCTAACCAAGCCTT pLKO.1 273 CDS 100% 2.640 1.848 N Map1lc3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026160.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04252 pDONR223 100% 85.1% 95.2% None (many diffs) n/a
2 ccsbBroad304_04252 pLX_304 0% 85.1% 95.2% V5 (many diffs) n/a
3 TRCN0000467838 TCCCTATCTAGTACACCTACTGAA pLX_317 100% 85.1% 95.2% V5 (many diffs) n/a
Download CSV