Transcript: Mouse NM_026210.4

Mus musculus trans-golgi network vesicle protein 23B (Tvp23b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tvp23b (67510)
Length:
1748
CDS:
95..712

Additional Resources:

NCBI RefSeq record:
NM_026210.4
NBCI Gene record:
Tvp23b (67510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194574 CCTGCGTTGGTGGAATCATAT pLKO.1 361 CDS 100% 13.200 9.240 N Tvp23b n/a
2 TRCN0000134426 GAATGTCACAGGTAGACTAAT pLKO.1 334 CDS 100% 13.200 9.240 N TVP23C n/a
3 TRCN0000176053 GTCTCACTGTTTGATGCAGAA pLKO.1 131 CDS 100% 4.050 2.835 N Tvp23b n/a
4 TRCN0000176231 GCTGTGTTTCTTTGTGACCAT pLKO.1 1293 3UTR 100% 2.640 1.848 N Tvp23b n/a
5 TRCN0000193978 GCAGTAAAGAATGTCACAGGT pLKO.1 326 CDS 100% 2.640 1.584 N Tvp23b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026210.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03181 pDONR223 100% 84.8% 92.1% None (many diffs) n/a
2 TRCN0000476923 CCCGGCCTAACCAGTGAGCTAGGA pLX_317 28.6% 84.8% 92.1% V5 (many diffs) n/a
Download CSV