Construct: ORF TRCN0000476923
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004278.1_s317c1
- Derived from:
- ccsbBroadEn_03181
- DNA Barcode:
- CCCGGCCTAACCAGTGAGCTAGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TVP23B (51030)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476923
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_016078.6 | 100% | 100% | |
| 2 | human | 201158 | TVP23C | trans-golgi network vesicle... | NM_001135036.1 | 95% | 92.8% | (many diffs) |
| 3 | human | 100533496 | TVP23C-CDRT4 | TVP23C-CDRT4 readthrough | NM_001204478.2 | 77.2% | 72.5% | (many diffs) |
| 4 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316924.2 | 75.1% | 75.1% | 462_463ins153 |
| 5 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316919.1 | 68.7% | 68.7% | 0_1ins192 |
| 6 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316920.1 | 68.7% | 68.7% | 0_1ins192 |
| 7 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316921.1 | 68.7% | 68.7% | 0_1ins192 |
| 8 | human | 201158 | TVP23C | trans-golgi network vesicle... | NM_145301.2 | 65.8% | 59% | (many diffs) |
| 9 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316922.1 | 58% | 58% | 0_1ins258 |
| 10 | human | 51030 | TVP23B | trans-golgi network vesicle... | NM_001316923.1 | 58% | 58% | 0_1ins258 |
| 11 | human | 100533496 | TVP23C-CDRT4 | TVP23C-CDRT4 readthrough | NR_037924.2 | 14.9% | (many diffs) | |
| 12 | mouse | 67510 | Tvp23b | trans-golgi network vesicle... | NM_026210.4 | 84.8% | 92.1% | (many diffs) |
| 13 | mouse | 67510 | Tvp23b | trans-golgi network vesicle... | XM_006534002.2 | 68.1% | 73.1% | (many diffs) |
| 14 | mouse | 67510 | Tvp23b | trans-golgi network vesicle... | XM_006534003.2 | 59.1% | 63.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 681
- ORF length:
- 615
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gcagcaggat agtaatgatg acactgaaga tgtttcactg tttgatgcgg 121 aagaggagac gactaataga ccaagaaaag ccaaaatcag acatccagta gcatcgtttt 181 tccacttatt ctttcgagtc agtgcaatca tcgtctatct tctctgtggg ttgctcagca 241 gcagctttat tacctgtatg gtgacaatta tcttgttgtt gtcgtgtgac ttttgggcag 301 tgaagaatgt cacaggtaga ctaatggttg gcctacgttg gtggaatcac attgatgaag 361 atggaaagag ccattgggtg tttgaatcta gaaaggagtc ctctcaagag aataaaactg 421 tgtcagaggc tgaatcaaga atcttttggt tgggacttat tgcctgtcca gtactgtggg 481 tgatatttgc ttttagtgca ctcttctccT TCAGAGTAAA GTGGTTGGCG GTGGTTATCA 541 TGGGTGTGGT GCTACAAGGT GCCAACCTGT ATGGTTACAT CAGGTGTAAG GTGCGCAGCA 601 GAAAGCATTT AACCAGCATG GCTACTTCAT ATTTTGGAAA GCAGTTTTTA AGACAAAACA 661 CTGGAGATGA TCAGACTTCC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 721 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 781 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCCG GCCTAACCAG 841 TGAGCTAGGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt