Transcript: Mouse NM_026402.3

Mus musculus autophagy related 3 (Atg3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Atg3 (67841)
Length:
2013
CDS:
272..1216

Additional Resources:

NCBI RefSeq record:
NM_026402.3
NBCI Gene record:
Atg3 (67841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257793 CCATGCTACAAGCGGTGTAAA pLKO_005 509 CDS 100% 13.200 18.480 N Atg3 n/a
2 TRCN0000147381 GCTGTCATTCCAACAATAGAA pLKO.1 1166 CDS 100% 5.625 7.875 N ATG3 n/a
3 TRCN0000278506 GCTGTCATTCCAACAATAGAA pLKO_005 1166 CDS 100% 5.625 7.875 N ATG3 n/a
4 TRCN0000184545 GCGGTGTAAACAGATGGAGTA pLKO.1 520 CDS 100% 4.050 5.670 N Atg3 n/a
5 TRCN0000247443 ATTTAAGGAAACGGGTGTAAT pLKO_005 352 CDS 100% 13.200 10.560 N Atg3 n/a
6 TRCN0000247441 TGTGACCATTGACCATATTTA pLKO_005 1279 3UTR 100% 15.000 10.500 N Atg3 n/a
7 TRCN0000216112 CAAGCTGTCATTCCAACAATA pLKO.1 1163 CDS 100% 13.200 9.240 N Atg3 n/a
8 TRCN0000215808 CATATCACAACACAGGTATTA pLKO.1 600 CDS 100% 13.200 9.240 N Atg3 n/a
9 TRCN0000247440 CATATCACAACACAGGTATTA pLKO_005 600 CDS 100% 13.200 9.240 N Atg3 n/a
10 TRCN0000247442 GTACATCACTTACGACAAATA pLKO_005 877 CDS 100% 13.200 9.240 N Atg3 n/a
11 TRCN0000183373 GTTAAGGAGATTACACTGGAA pLKO.1 638 CDS 100% 2.640 1.848 N Atg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03950 pDONR223 100% 92.3% 97.4% None (many diffs) n/a
2 ccsbBroad304_03950 pLX_304 0% 92.3% 97.4% V5 (many diffs) n/a
3 TRCN0000469229 ACTGCAGCGCCGCATAGACTTTGA pLX_317 43.8% 92.3% 97.4% V5 (many diffs) n/a
Download CSV