Transcript: Mouse NM_026496.4

Mus musculus grainyhead-like 2 (Drosophila) (Grhl2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Grhl2 (252973)
Length:
4950
CDS:
352..2229

Additional Resources:

NCBI RefSeq record:
NM_026496.4
NBCI Gene record:
Grhl2 (252973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026496.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310951 GAGCCTGGTAGGCCCTTATTT pLKO_005 2455 3UTR 100% 15.000 21.000 N Grhl2 n/a
2 TRCN0000084223 CGGAGAAATTTCGGAGTACTT pLKO.1 1025 CDS 100% 4.950 6.930 N Grhl2 n/a
3 TRCN0000084224 CGTCCTTGTTAAGCGGATGTT pLKO.1 1875 CDS 100% 4.950 6.930 N Grhl2 n/a
4 TRCN0000316008 CGTCCTTGTTAAGCGGATGTT pLKO_005 1875 CDS 100% 4.950 6.930 N Grhl2 n/a
5 TRCN0000304360 CACCGTCTAAGCAGATCAAAG pLKO_005 1925 CDS 100% 10.800 8.640 N Grhl2 n/a
6 TRCN0000084226 CGCATACAATGCTGTTTCCTT pLKO.1 1401 CDS 100% 3.000 2.400 N Grhl2 n/a
7 TRCN0000310950 CCAGTGAAGCCCAGATCAATT pLKO_005 650 CDS 100% 13.200 9.240 N Grhl2 n/a
8 TRCN0000084225 CCTCAACAAAGGACAATTCTA pLKO.1 1158 CDS 100% 5.625 3.938 N Grhl2 n/a
9 TRCN0000084227 CCTGGTCAACATGGATGACAA pLKO.1 2118 CDS 100% 4.950 3.465 N Grhl2 n/a
10 TRCN0000316009 CCTGGTCAACATGGATGACAA pLKO_005 2118 CDS 100% 4.950 3.465 N Grhl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026496.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04157 pDONR223 100% 88.3% 94.7% None (many diffs) n/a
2 ccsbBroad304_04157 pLX_304 0% 88.3% 94.7% V5 (many diffs) n/a
Download CSV