Transcript: Mouse NM_026518.4

Mus musculus ring finger protein 146 (Rnf146), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rnf146 (68031)
Length:
4339
CDS:
611..1690

Additional Resources:

NCBI RefSeq record:
NM_026518.4
NBCI Gene record:
Rnf146 (68031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026518.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306563 ATTTCTGCCCACGTAACATTA pLKO_005 1738 3UTR 100% 13.200 18.480 N Rnf146 n/a
2 TRCN0000033980 GCAGGAAGATTAAGCGAGATA pLKO.1 1101 CDS 100% 4.950 6.930 N RNF146 n/a
3 TRCN0000040724 CGGAAATGTTAATTGCTGGAT pLKO.1 1020 CDS 100% 2.640 2.112 N Rnf146 n/a
4 TRCN0000332722 CGGAAATGTTAATTGCTGGAT pLKO_005 1020 CDS 100% 2.640 2.112 N Rnf146 n/a
5 TRCN0000040725 CCTACAAATAAGAAGGCAAAT pLKO.1 659 CDS 100% 10.800 7.560 N Rnf146 n/a
6 TRCN0000040723 CCTCCGTTGAAGAAACAGAAT pLKO.1 1458 CDS 100% 4.950 3.465 N Rnf146 n/a
7 TRCN0000332640 CCTCCGTTGAAGAAACAGAAT pLKO_005 1458 CDS 100% 4.950 3.465 N Rnf146 n/a
8 TRCN0000040727 GACAAGAGATTCCTGAGGATT pLKO.1 837 CDS 100% 4.950 3.465 N Rnf146 n/a
9 TRCN0000332641 GACAAGAGATTCCTGAGGATT pLKO_005 837 CDS 100% 4.950 3.465 N Rnf146 n/a
10 TRCN0000040726 CCTGTTCCAATACTGCACCTT pLKO.1 684 CDS 100% 2.640 1.848 N Rnf146 n/a
11 TRCN0000332639 CCTGTTCCAATACTGCACCTT pLKO_005 684 CDS 100% 2.640 1.848 N Rnf146 n/a
12 TRCN0000033982 GCCAGTAGTGATAGTGAGGAT pLKO.1 1484 CDS 100% 2.640 1.848 N RNF146 n/a
13 TRCN0000033983 GCTCATTTACAACTCAGTGGA pLKO.1 1358 CDS 100% 2.640 1.848 N RNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026518.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04256 pDONR223 100% 89.1% 92.2% None (many diffs) n/a
2 ccsbBroad304_04256 pLX_304 0% 89.1% 92.2% V5 (many diffs) n/a
3 TRCN0000478817 ATATCTCTCAGTCTGCGAATTCAA pLX_317 34.4% 89.1% 92.2% V5 (many diffs) n/a
Download CSV