Transcript: Mouse NM_026529.4

Mus musculus RIKEN cDNA 2700062C07 gene (2700062C07Rik), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
2700062C07Rik (68046)
Length:
1032
CDS:
34..687

Additional Resources:

NCBI RefSeq record:
NM_026529.4
NBCI Gene record:
2700062C07Rik (68046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181243 CTACAAGTGTGCTGCTGATTA pLKO.1 320 CDS 100% 13.200 9.240 N 2700062C07Rik n/a
2 TRCN0000353616 CTACAAGTGTGCTGCTGATTA pLKO_005 320 CDS 100% 13.200 9.240 N 2700062C07Rik n/a
3 TRCN0000329506 GAAGAGAATGGCCTCTGAAAG pLKO_005 686 CDS 100% 10.800 7.560 N 2700062C07Rik n/a
4 TRCN0000329439 GGACTTCAGGCACTTCTTATC pLKO_005 657 CDS 100% 10.800 7.560 N 2700062C07Rik n/a
5 TRCN0000376979 ACTTCTTATCTTCTCTATGAA pLKO_005 668 CDS 100% 5.625 3.938 N 2700062C07Rik n/a
6 TRCN0000376902 AGCACATGGAAACCAAGTCAA pLKO_005 750 3UTR 100% 4.950 3.465 N 2700062C07Rik n/a
7 TRCN0000177651 CAGAGTACAAATGGTTCCAAA pLKO.1 487 CDS 100% 4.950 3.465 N 2700062C07Rik n/a
8 TRCN0000176564 CCAAAGATACAGAAACTTCTT pLKO.1 232 CDS 100% 4.950 3.465 N 2700062C07Rik n/a
9 TRCN0000329438 CCAAAGATACAGAAACTTCTT pLKO_005 232 CDS 100% 4.950 3.465 N 2700062C07Rik n/a
10 TRCN0000181222 CCTGTAGAACATGCAACAGAA pLKO.1 341 CDS 100% 4.950 3.465 N 2700062C07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.