Transcript: Mouse NM_026532.3

Mus musculus nuclear transport factor 2 (Nutf2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nutf2 (68051)
Length:
1966
CDS:
99..482

Additional Resources:

NCBI RefSeq record:
NM_026532.3
NBCI Gene record:
Nutf2 (68051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079796 CCCAACTAGGCGCAATTTATA pLKO.1 178 CDS 100% 15.000 7.500 Y Nutf2 n/a
2 TRCN0000038552 GAACCCAACTAGGCGCAATTT pLKO.1 175 CDS 100% 13.200 6.600 Y NUTF2 n/a
3 TRCN0000300236 GAACCCAACTAGGCGCAATTT pLKO_005 175 CDS 100% 13.200 6.600 Y NUTF2 n/a
4 TRCN0000444405 TCAATGCCTCATGATACAATA pLKO_005 858 3UTR 100% 13.200 6.600 Y Nutf2 n/a
5 TRCN0000079795 GATCCAGCTTTATTCAACATT pLKO.1 130 CDS 100% 5.625 2.813 Y Nutf2 n/a
6 TRCN0000038553 GATGCTTGGGTTTGCACCAAT pLKO.1 426 CDS 100% 4.950 2.475 Y NUTF2 n/a
7 TRCN0000333495 GATGCTTGGGTTTGCACCAAT pLKO_005 426 CDS 100% 4.950 2.475 Y NUTF2 n/a
8 TRCN0000079793 GCTCCAAATATCATACACAAA pLKO.1 550 3UTR 100% 4.950 2.475 Y Nutf2 n/a
9 TRCN0000038550 ACATCAACGATGCTTGGGTTT pLKO.1 418 CDS 100% 4.050 2.025 Y NUTF2 n/a
10 TRCN0000333504 ACATCAACGATGCTTGGGTTT pLKO_005 418 CDS 100% 4.050 2.025 Y NUTF2 n/a
11 TRCN0000185068 CTACCAGTTATTTGATAACGA pLKO.1 152 CDS 100% 3.000 1.500 Y NUTF2P4 n/a
12 TRCN0000079794 GCGCAATTTATATTGATGCAT pLKO.1 187 CDS 100% 3.000 1.500 Y Nutf2 n/a
13 TRCN0000038551 AGATAGCTGCATCATCAGCAT pLKO.1 329 CDS 100% 2.640 1.320 Y NUTF2 n/a
14 TRCN0000333562 AGATAGCTGCATCATCAGCAT pLKO_005 329 CDS 100% 2.640 1.320 Y NUTF2 n/a
15 TRCN0000079797 GAAGCTATCTAGCCTTCCGTT pLKO.1 260 CDS 100% 2.640 1.320 Y Nutf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02352 pDONR223 100% 94.2% 100% None (many diffs) n/a
2 ccsbBroad304_02352 pLX_304 0% 94.2% 100% V5 (many diffs) n/a
3 TRCN0000471183 GCCTTTTACTTTGTGCATCCCTAC pLX_317 98.5% 94.2% 100% V5 (many diffs) n/a
Download CSV