Transcript: Mouse NM_026571.2

Mus musculus lipoma HMGIC fusion partner-like 5 (Lhfpl5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lhfpl5 (328789)
Length:
1275
CDS:
283..942

Additional Resources:

NCBI RefSeq record:
NM_026571.2
NBCI Gene record:
Lhfpl5 (328789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189933 GTCTAGTCTACCCAGATGGTT pLKO.1 716 CDS 100% 3.000 4.200 N Lhfpl5 n/a
2 TRCN0000191388 CAATTCTAACAGCTGAAGAAA pLKO.1 966 3UTR 100% 5.625 3.938 N Lhfpl5 n/a
3 TRCN0000131070 CCTTCAAGACTGCCATGTTCT pLKO.1 560 CDS 100% 4.950 3.465 N LHFPL5 n/a
4 TRCN0000189878 CTGTAATACAGCCACGGTCTA pLKO.1 642 CDS 100% 4.050 2.835 N Lhfpl5 n/a
5 TRCN0000190495 GCAGCAACAATTCTAACAGCT pLKO.1 959 3UTR 100% 2.640 1.848 N Lhfpl5 n/a
6 TRCN0000127894 CTTCAAGACTGCCATGTTCTT pLKO.1 561 CDS 100% 4.950 2.970 N LHFPL5 n/a
7 TRCN0000131065 CATCATCTGCTTCAGCCTGTT pLKO.1 615 CDS 100% 4.050 2.430 N LHFPL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09884 pDONR223 100% 89.4% 98.1% None (many diffs) n/a
2 ccsbBroad304_09884 pLX_304 0% 89.4% 98.1% V5 (many diffs) n/a
3 TRCN0000465705 CTCAGGCAAGTTTACGCTTGATTT pLX_317 50.3% 89.4% 98.1% V5 (many diffs) n/a
Download CSV