Transcript: Mouse NM_026588.1

Mus musculus syntaxin 19 (Stx19), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stx19 (68159)
Length:
1205
CDS:
289..1167

Additional Resources:

NCBI RefSeq record:
NM_026588.1
NBCI Gene record:
Stx19 (68159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452757 CACTGGGTGACGTAGTCAAAG pLKO_005 605 CDS 100% 10.800 15.120 N Stx19 n/a
2 TRCN0000100921 GAGAAGGTTTAGTCTACTTAA pLKO.1 528 CDS 100% 13.200 10.560 N Stx19 n/a
3 TRCN0000100922 CCAGCAAACCATGTTTCTATA pLKO.1 714 CDS 100% 13.200 9.240 N Stx19 n/a
4 TRCN0000450864 GAAATTTGGACTGGCTGTAAA pLKO_005 1080 CDS 100% 13.200 9.240 N Stx19 n/a
5 TRCN0000100924 GTGGATGATGTTCAACGATTT pLKO.1 475 CDS 100% 10.800 7.560 N Stx19 n/a
6 TRCN0000100923 TCCATGAGAAGGTTTAGTCTA pLKO.1 523 CDS 100% 4.950 3.465 N Stx19 n/a
7 TRCN0000100920 GCTTACTTACAGAAACCAGTA pLKO.1 872 CDS 100% 4.050 2.835 N Stx19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05664 pDONR223 100% 85% 85.7% None (many diffs) n/a
2 ccsbBroad304_05664 pLX_304 0% 85% 85.7% V5 (many diffs) n/a
3 TRCN0000471044 TCTTTCGACTCATCCGAGCTAAGA pLX_317 38.2% 85% 85.7% V5 (many diffs) n/a
Download CSV