Transcript: Mouse NM_026602.3

Mus musculus breast carcinoma amplified sequence 2 (Bcas2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bcas2 (68183)
Length:
1422
CDS:
63..740

Additional Resources:

NCBI RefSeq record:
NM_026602.3
NBCI Gene record:
Bcas2 (68183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123426 GCTCGACAACCGATTGAATTA pLKO.1 285 CDS 100% 13.200 18.480 N Bcas2 n/a
2 TRCN0000324257 GCTCGACAACCGATTGAATTA pLKO_005 285 CDS 100% 13.200 18.480 N Bcas2 n/a
3 TRCN0000074950 CCCGGATTATTCTGCCTTTGA pLKO.1 227 CDS 100% 4.950 6.930 N BCAS2 n/a
4 TRCN0000290972 CCCGGATTATTCTGCCTTTGA pLKO_005 227 CDS 100% 4.950 6.930 N BCAS2 n/a
5 TRCN0000123425 CGGATTATTCTGCCTTTGAAA pLKO.1 229 CDS 100% 5.625 3.938 N Bcas2 n/a
6 TRCN0000324258 CGGATTATTCTGCCTTTGAAA pLKO_005 229 CDS 100% 5.625 3.938 N Bcas2 n/a
7 TRCN0000123428 CTCAGCATGAAACGATATGAA pLKO.1 306 CDS 100% 5.625 3.938 N Bcas2 n/a
8 TRCN0000324255 CTCAGCATGAAACGATATGAA pLKO_005 306 CDS 100% 5.625 3.938 N Bcas2 n/a
9 TRCN0000123427 GCAGCTTACAGCTGGATCTAA pLKO.1 572 CDS 100% 5.625 3.938 N Bcas2 n/a
10 TRCN0000324256 GCAGCTTACAGCTGGATCTAA pLKO_005 572 CDS 100% 5.625 3.938 N Bcas2 n/a
11 TRCN0000123424 CCATGGACTATGTAAACTGTT pLKO.1 817 3UTR 100% 4.950 3.465 N Bcas2 n/a
12 TRCN0000324328 CCATGGACTATGTAAACTGTT pLKO_005 817 3UTR 100% 4.950 3.465 N Bcas2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02385 pDONR223 100% 89% 100% None (many diffs) n/a
2 ccsbBroad304_02385 pLX_304 0% 89% 100% V5 (many diffs) n/a
3 TRCN0000470454 GACTTCTTGCCTGACTATCGTGCC pLX_317 67.3% 89% 100% V5 (many diffs) n/a
Download CSV