Transcript: Mouse NM_026698.2

Mus musculus transmembrane protein 129 (Tmem129), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmem129 (68366)
Length:
2259
CDS:
6..1094

Additional Resources:

NCBI RefSeq record:
NM_026698.2
NBCI Gene record:
Tmem129 (68366)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376265 GATCTCTCGCCAGACTCAAAC pLKO_005 597 CDS 100% 10.800 15.120 N Tmem129 n/a
2 TRCN0000342032 TACGCTGAGCATCACAGTATG pLKO_005 1087 CDS 100% 10.800 15.120 N Tmem129 n/a
3 TRCN0000352712 TCCGACGGATTGACAAGTTTG pLKO_005 451 CDS 100% 10.800 15.120 N Tmem129 n/a
4 TRCN0000376266 TTCCTCACGAGGGTTGCATAT pLKO_005 1587 3UTR 100% 10.800 8.640 N Tmem129 n/a
5 TRCN0000342099 TGACAAGAGGTTCTAGTTAAA pLKO_005 1159 3UTR 100% 13.200 9.240 N Tmem129 n/a
6 TRCN0000342034 ATCAGAATATGGCGAACTATG pLKO_005 695 CDS 100% 10.800 7.560 N Tmem129 n/a
7 TRCN0000342036 GTGACAGACACATGGGTAATG pLKO_005 501 CDS 100% 10.800 7.560 N Tmem129 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04575 pDONR223 100% 84.4% 89.2% None (many diffs) n/a
2 ccsbBroad304_04575 pLX_304 0% 84.4% 89.2% V5 (many diffs) n/a
3 TRCN0000476429 AAGTAAGTGTTAATCTAGTACCCT pLX_317 31.1% 84.4% 89.2% V5 (many diffs) n/a
4 TRCN0000467129 AATGAGAAATCGCCCGGTTAGTGC pLX_317 61% 54.1% 55.2% V5 (many diffs) n/a
5 ccsbBroadEn_09335 pDONR223 100% 53.9% 54.9% None (many diffs) n/a
6 ccsbBroad304_09335 pLX_304 0% 53.9% 54.9% V5 (many diffs) n/a
Download CSV