Transcript: Mouse NM_026735.2

Mus musculus MOB kinase activator 1B (Mob1b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mob1b (68473)
Length:
3171
CDS:
238..888

Additional Resources:

NCBI RefSeq record:
NM_026735.2
NBCI Gene record:
Mob1b (68473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026735.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088861 TGTTCCATTCCCGAAGAATTT pLKO.1 648 CDS 100% 13.200 10.560 N Mob1b n/a
2 TRCN0000324163 TGTTCCATTCCCGAAGAATTT pLKO_005 648 CDS 100% 13.200 10.560 N Mob1b n/a
3 TRCN0000376239 CTGGATGATGAGACATTATTT pLKO_005 613 CDS 100% 15.000 10.500 N Mob1b n/a
4 TRCN0000088860 GCTCATATTTATCACCAACAT pLKO.1 715 CDS 100% 4.950 3.465 N Mob1b n/a
5 TRCN0000324102 GCTCATATTTATCACCAACAT pLKO_005 715 CDS 100% 4.950 3.465 N Mob1b n/a
6 TRCN0000088859 GCTTTATGGAACCATCACAGA pLKO.1 447 CDS 100% 2.640 1.848 N Mob1b n/a
7 TRCN0000088862 CCACTGCAAGAGCTGATTGAA pLKO.1 844 CDS 100% 5.625 3.375 N Mob1b n/a
8 TRCN0000324103 CCACTGCAAGAGCTGATTGAA pLKO_005 844 CDS 100% 5.625 3.375 N Mob1b n/a
9 TRCN0000088858 GCTGGAAACAAATGCGACAAA pLKO.1 1181 3UTR 100% 4.950 2.970 N Mob1b n/a
10 TRCN0000324162 GCTGGAAACAAATGCGACAAA pLKO_005 1181 3UTR 100% 4.950 2.970 N Mob1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026735.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04583 pDONR223 100% 91.8% 100% None (many diffs) n/a
2 ccsbBroad304_04583 pLX_304 0% 91.8% 100% V5 (many diffs) n/a
3 TRCN0000475329 TCGAATGCTGCACACATTGCGCCT pLX_317 70.3% 91.8% 100% V5 (many diffs) n/a
4 ccsbBroadEn_14192 pDONR223 100% 78.9% 94.4% None (many diffs) n/a
5 ccsbBroad304_14192 pLX_304 0% 78.9% 94.4% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000492273 CTACTATATTAGCGCGTGCACTCC pLX_317 77% 78.9% 94.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV