Transcript: Mouse NM_026998.3

Mus musculus sorting nexin 6 (Snx6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Snx6 (72183)
Length:
1879
CDS:
10..1230

Additional Resources:

NCBI RefSeq record:
NM_026998.3
NBCI Gene record:
Snx6 (72183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313599 GGGTTGCAGCGCATCCTATTT pLKO_005 458 CDS 100% 13.200 18.480 N Snx6 n/a
2 TRCN0000093412 CCGTTCACACAAAGAGTTCAT pLKO.1 155 CDS 100% 4.950 6.930 N Snx6 n/a
3 TRCN0000317100 CCGTTCACACAAAGAGTTCAT pLKO_005 155 CDS 100% 4.950 6.930 N Snx6 n/a
4 TRCN0000093410 CGCGGACTTAAAGCAATAAAT pLKO.1 58 CDS 100% 15.000 12.000 N Snx6 n/a
5 TRCN0000093409 CCTGTCTTACTGTGTTTATTT pLKO.1 1468 3UTR 100% 15.000 10.500 N Snx6 n/a
6 TRCN0000313600 AGAGTATCACAACCGAGTTAA pLKO_005 663 CDS 100% 13.200 9.240 N Snx6 n/a
7 TRCN0000313601 TATCTGTGTAAAGCGTCTTAA pLKO_005 1638 3UTR 100% 13.200 9.240 N Snx6 n/a
8 TRCN0000093413 CCAACAGTTGTGCTGTCAGAA pLKO.1 1038 CDS 100% 4.950 3.465 N Snx6 n/a
9 TRCN0000093411 GCAGAACTAGAACTGAAGCAT pLKO.1 1150 CDS 100% 3.000 2.100 N Snx6 n/a
10 TRCN0000313602 TCAAGCTCTCTGACCTATTAA pLKO_005 878 CDS 100% 15.000 9.000 N Snx6 n/a
11 TRCN0000344955 TTTGAGCACGAACGAACATTT pLKO_005 637 CDS 100% 13.200 10.560 N SNX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08782 pDONR223 100% 64.4% 71.1% None (many diffs) n/a
2 ccsbBroad304_08782 pLX_304 0% 64.4% 71.1% V5 (many diffs) n/a
3 TRCN0000474181 TTTGACCATTAGTGTCGTAATCCC pLX_317 47% 64.4% 71.1% V5 (many diffs) n/a
Download CSV