Transcript: Mouse NM_027204.2

Mus musculus mitochondrial ribosomal protein L12 (Mrpl12), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrpl12 (56282)
Length:
963
CDS:
24..629

Additional Resources:

NCBI RefSeq record:
NM_027204.2
NBCI Gene record:
Mrpl12 (56282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102523 CTCAACGAACTCCTGAAGAAA pLKO.1 270 CDS 100% 5.625 3.938 N Mrpl12 n/a
2 TRCN0000324710 CTCAACGAACTCCTGAAGAAA pLKO_005 270 CDS 100% 5.625 3.938 N Mrpl12 n/a
3 TRCN0000102524 GCAAAGCCTGTGGACAAAGTA pLKO.1 441 CDS 100% 5.625 3.938 N Mrpl12 n/a
4 TRCN0000324711 GCAAAGCCTGTGGACAAAGTA pLKO_005 441 CDS 100% 5.625 3.938 N Mrpl12 n/a
5 TRCN0000102521 CCTCTGGATAATGCTCCCAAA pLKO.1 180 CDS 100% 4.050 2.835 N Mrpl12 n/a
6 TRCN0000102520 GCAGTGACAACCTTTGCAGAA pLKO.1 789 3UTR 100% 4.050 2.835 N Mrpl12 n/a
7 TRCN0000353869 GCAGTGACAACCTTTGCAGAA pLKO_005 789 3UTR 100% 4.050 2.835 N Mrpl12 n/a
8 TRCN0000102522 CGAGAAGATCAAAGCAGCCTT pLKO.1 575 CDS 100% 2.640 1.848 N Mrpl12 n/a
9 TRCN0000324709 CGAGAAGATCAAAGCAGCCTT pLKO_005 575 CDS 100% 2.640 1.848 N Mrpl12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01443 pDONR223 100% 84% 84.5% None (many diffs) n/a
2 ccsbBroad304_01443 pLX_304 0% 84% 84.5% V5 (many diffs) n/a
3 TRCN0000472448 ATCTGACCCAGTCCAAGTCTTGCG pLX_317 85.1% 84% 84.5% V5 (many diffs) n/a
Download CSV