Transcript: Mouse NM_027280.3

Mus musculus naked cuticle 1 (Nkd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Mus musculus (mouse)
Gene:
Nkd1 (93960)
Length:
4314
CDS:
164..1579

Additional Resources:

NCBI RefSeq record:
NM_027280.3
NBCI Gene record:
Nkd1 (93960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251956 CCACACCCTAAGGCATTATTA pLKO_005 1612 3UTR 100% 15.000 10.500 N Nkd1 n/a
2 TRCN0000257557 AGTGGACTTTCACTCTATATG pLKO_005 573 CDS 100% 13.200 9.240 N Nkd1 n/a
3 TRCN0000251954 ACCATTACCACCACTTCTATC pLKO_005 1551 CDS 100% 10.800 7.560 N Nkd1 n/a
4 TRCN0000251957 ATTGCGTGGATGAGAACATTG pLKO_005 903 CDS 100% 10.800 7.560 N Nkd1 n/a
5 TRCN0000251955 GCTTGCTGCATACCATCTATG pLKO_005 636 CDS 100% 10.800 7.560 N Nkd1 n/a
6 TRCN0000178667 CACCATTACCACCACTTCTAT pLKO.1 1550 CDS 100% 5.625 3.938 N Nkd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09261 pDONR223 100% 85.7% 87% None (many diffs) n/a
2 TRCN0000476866 AGGACGTCATAGCTCCTTAAATTT pLX_317 3.9% 85.7% 87% V5 (many diffs) n/a
Download CSV