Transcript: Mouse NM_027315.4

Mus musculus ubiquitin-conjugating enzyme E2Q family member 1 (Ube2q1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ube2q1 (70093)
Length:
3081
CDS:
104..1372

Additional Resources:

NCBI RefSeq record:
NM_027315.4
NBCI Gene record:
Ube2q1 (70093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337760 AGACCTAGATCACTATGAAAT pLKO_005 700 CDS 100% 13.200 18.480 N Ube2q1 n/a
2 TRCN0000337831 ACTCTCAAGCCTCCTTATATT pLKO_005 1641 3UTR 100% 15.000 10.500 N Ube2q1 n/a
3 TRCN0000337834 TGAAGGAGCTCAGGGATATAT pLKO_005 873 CDS 100% 15.000 10.500 N Ube2q1 n/a
4 TRCN0000337833 ACCAGAGGCAAGATTACTTAA pLKO_005 810 CDS 100% 13.200 9.240 N Ube2q1 n/a
5 TRCN0000337761 AGCAGACTTCATCCTACTTAA pLKO_005 1036 CDS 100% 13.200 9.240 N Ube2q1 n/a
6 TRCN0000040859 CCTACTTAACTTCTCCTTTAA pLKO.1 1048 CDS 100% 13.200 9.240 N Ube2q1 n/a
7 TRCN0000004201 CACTATGAAATGAAAGAGGAA pLKO.1 710 CDS 100% 2.640 1.584 N UBE2Q1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14201 pDONR223 100% 15.7% 16.5% None (many diffs) n/a
2 ccsbBroad304_14201 pLX_304 0% 15.7% 16.5% V5 (many diffs) n/a
3 TRCN0000465855 TCATACGATCATAGCGAAGCCTTT pLX_317 100% 15.7% 16.5% V5 (many diffs) n/a
Download CSV