Transcript: Mouse NM_027402.4

Mus musculus fibronectin type III domain containing 5 (Fndc5), mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Mus musculus (mouse)
Gene:
Fndc5 (384061)
Length:
2779
CDS:
81..710

Additional Resources:

NCBI RefSeq record:
NM_027402.4
NBCI Gene record:
Fndc5 (384061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098527 GACACAGAATATATCGTCCAT pLKO.1 363 CDS 100% 2.640 3.696 N Fndc5 n/a
2 TRCN0000098529 GTGCGGATGCTCCGGTTCATT pLKO.1 291 CDS 100% 1.875 2.625 N Fndc5 n/a
3 TRCN0000098526 CGAGCCCAATAACAACAAGGA pLKO.1 617 CDS 100% 2.640 1.848 N Fndc5 n/a
4 TRCN0000098528 GCTCTCTTCTGCCGCCAGTAT pLKO.1 579 CDS 100% 1.650 1.155 N Fndc5 n/a
5 TRCN0000098525 CCCTCTGTGAACATCATCAAA pLKO.1 1277 3UTR 100% 5.625 3.375 N Fndc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05288 pDONR223 100% 54.3% 60.4% None (many diffs) n/a
2 ccsbBroad304_05288 pLX_304 0% 54.3% 60.4% V5 (many diffs) n/a
3 TRCN0000469555 ATCGGCGATACGACGTTCCCAATC pLX_317 98.7% 54.3% 60.4% V5 (many diffs) n/a
Download CSV