Transcript: Mouse NM_027416.3

Mus musculus calmodulin-like 3 (Calml3), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Calml3 (70405)
Length:
1426
CDS:
116..565

Additional Resources:

NCBI RefSeq record:
NM_027416.3
NBCI Gene record:
Calml3 (70405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097178 CGCCGAGTTCAAAGAGGCTTT pLKO.1 145 CDS 100% 4.050 5.670 N Calml3 n/a
2 TRCN0000097174 CCTTTCACTTTCTGCATCTTA pLKO.1 724 3UTR 100% 5.625 3.938 N Calml3 n/a
3 TRCN0000097176 CATGGTGAATGAAATTGACAA pLKO.1 268 CDS 100% 4.950 3.465 N Calml3 n/a
4 TRCN0000097177 GAGCTTCAAGGCATGGTGAAT pLKO.1 257 CDS 100% 4.950 3.465 N Calml3 n/a
5 TRCN0000097175 GCAAGTGAACTATGAGGAGTT pLKO.1 520 CDS 100% 4.050 2.835 N Calml3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00209 pDONR223 100% 84.3% 89.2% None (many diffs) n/a
2 ccsbBroad304_00209 pLX_304 0% 84.3% 89.2% V5 (many diffs) n/a
3 TRCN0000465706 TCCGATATATCCAATCTGGCCCCT pLX_317 72.8% 84.3% 89.2% V5 (many diffs) n/a
4 ccsbBroadEn_00208 pDONR223 100% 80.3% 87.2% None (many diffs) n/a
5 ccsbBroad304_00208 pLX_304 0% 80.3% 87.2% V5 (many diffs) n/a
6 TRCN0000469481 ATCTGGCTTATGCACTTAGGCCTT pLX_317 72.8% 80.3% 87.2% V5 (many diffs) n/a
7 ccsbBroadEn_14560 pDONR223 0% 80.3% 87.2% None (many diffs) n/a
8 ccsbBroad304_14560 pLX_304 0% 80.3% 87.2% V5 (many diffs) n/a
9 TRCN0000479431 ATTAGCCGATGATTAAAGGATATG pLX_317 73.4% 80.3% 87.2% V5 (many diffs) n/a
Download CSV