Transcript: Mouse NM_027492.2

Mus musculus N(alpha)-acetyltransferase 30, NatC catalytic subunit (Naa30), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Naa30 (70646)
Length:
4429
CDS:
134..1228

Additional Resources:

NCBI RefSeq record:
NM_027492.2
NBCI Gene record:
Naa30 (70646)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251775 ACTACTTAACTCGGGAATAAT pLKO_005 3827 3UTR 100% 15.000 21.000 N Naa30 n/a
2 TRCN0000265241 AGTTGACGCACTGCGACTTAA pLKO_005 1192 CDS 100% 13.200 18.480 N Naa30 n/a
3 TRCN0000251773 ACGATACGATACGTCCGATAT pLKO_005 773 CDS 100% 10.800 15.120 N Naa30 n/a
4 TRCN0000251774 CCTACTCCATTTATACGTATA pLKO_005 852 CDS 100% 10.800 15.120 N Naa30 n/a
5 TRCN0000155008 GCCATCGTTTGCAAGTTGGAT pLKO.1 938 CDS 100% 3.000 4.200 N NAA30 n/a
6 TRCN0000265329 GATGTTCCGCAGAGGTTATAT pLKO_005 970 CDS 100% 15.000 12.000 N Naa30 n/a
7 TRCN0000151593 GAGGCTGTTCAGATACTATTT pLKO.1 1165 CDS 100% 13.200 9.240 N NAA30 n/a
8 TRCN0000153088 GCAGAGGTTATATAGCCATGT pLKO.1 978 CDS 100% 4.050 2.835 N NAA30 n/a
9 TRCN0000150348 CCTCCATTAACAGTTGGTAAA pLKO.1 2727 3UTR 100% 10.800 6.480 N NAA30 n/a
10 TRCN0000151404 GCATTGGTACTAACTTGGTTA pLKO.1 1029 CDS 100% 4.950 3.960 N NAA30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04768 pDONR223 100% 87.1% 86.2% None (many diffs) n/a
2 ccsbBroad304_04768 pLX_304 0% 87.1% 86.2% V5 (many diffs) n/a
3 TRCN0000474949 AATTCTCGAGTCCTTGTCACCTCT pLX_317 40.6% 87.1% 86.2% V5 (many diffs) n/a
4 ccsbBroadEn_13093 pDONR223 100% 79.5% 79.6% None (many diffs) n/a
5 ccsbBroad304_13093 pLX_304 0% 79.5% 79.6% V5 (many diffs) n/a
6 TRCN0000475537 TAACTGTATGTGCAGATGAGCTAC pLX_317 28.2% 79.5% 79.6% V5 (many diffs) n/a
Download CSV