Transcript: Mouse NM_027619.4

Mus musculus tetratricopeptide repeat domain 14 (Ttc14), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Ttc14 (67120)
Length:
7692
CDS:
97..2397

Additional Resources:

NCBI RefSeq record:
NM_027619.4
NBCI Gene record:
Ttc14 (67120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094016 CGAGATATTGAACGTGGTGAT pLKO.1 454 CDS 100% 4.050 5.670 N Ttc14 n/a
2 TRCN0000094015 CGTGAGAGATATTTCGCACTT pLKO.1 549 CDS 100% 4.050 5.670 N Ttc14 n/a
3 TRCN0000094017 GCCCAACTCATAGGAATGCAA pLKO.1 1205 CDS 100% 3.000 4.200 N Ttc14 n/a
4 TRCN0000094018 GAGATATTGAACGTGGTGATA pLKO.1 455 CDS 100% 4.950 3.465 N Ttc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05053 pDONR223 100% 87.1% 86.8% None (many diffs) n/a
2 ccsbBroad304_05053 pLX_304 0% 87.1% 86.8% V5 (many diffs) n/a
3 TRCN0000467798 TCTAAGTAAAGCATAAAATGGTCC pLX_317 18.6% 87.1% 86.8% V5 (many diffs) n/a
Download CSV