Transcript: Mouse NM_027726.1

Mus musculus discs, large homolog 5 (Drosophila) (Dlg5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Dlg5 (71228)
Length:
7809
CDS:
471..6167

Additional Resources:

NCBI RefSeq record:
NM_027726.1
NBCI Gene record:
Dlg5 (71228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025000 GCATTGCTGATGGTCGCTTAA pLKO.1 2389 CDS 100% 10.800 15.120 N Dlg5 n/a
2 TRCN0000339145 GCATTGCTGATGGTCGCTTAA pLKO_005 2389 CDS 100% 10.800 15.120 N Dlg5 n/a
3 TRCN0000025002 GCACTGGACAATAAGTCTCTA pLKO.1 2703 CDS 100% 4.950 6.930 N Dlg5 n/a
4 TRCN0000339146 GCACTGGACAATAAGTCTCTA pLKO_005 2703 CDS 100% 4.950 6.930 N Dlg5 n/a
5 TRCN0000025003 CCTTTACTGGATGTGGTGAAA pLKO.1 5646 CDS 100% 4.950 3.960 N Dlg5 n/a
6 TRCN0000339147 CCTTTACTGGATGTGGTGAAA pLKO_005 5646 CDS 100% 4.950 3.960 N Dlg5 n/a
7 TRCN0000025001 CCACAGGCTGAATCCTGATTA pLKO.1 944 CDS 100% 13.200 9.240 N Dlg5 n/a
8 TRCN0000024999 CCTGAGAAACTCTCTGTGTAT pLKO.1 3273 CDS 100% 4.950 3.465 N Dlg5 n/a
9 TRCN0000339080 CCTGAGAAACTCTCTGTGTAT pLKO_005 3273 CDS 100% 4.950 3.465 N Dlg5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489080 GGCACTCATTCGATCTGATTAACT pLX_317 15.6% 31% 32.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV